Incidental Mutation 'R6332:Agt'
ID513176
Institutional Source Beutler Lab
Gene Symbol Agt
Ensembl Gene ENSMUSG00000031980
Gene Nameangiotensinogen (serpin peptidase inhibitor, clade A, member 8)
SynonymsAogen, angiotensin precursor, Serpina8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6332 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124556534-124569706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 124557833 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 389 (Q389K)
Ref Sequence ENSEMBL: ENSMUSP00000066488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063278]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063278
AA Change: Q389K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066488
Gene: ENSMUSG00000031980
AA Change: Q389K

DomainStartEndE-ValueType
SERPIN 111 478 6.63e-57 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the liver and is cleaved by the enzyme renin in response to lowered blood pressure. The resulting product, angiotensin I, is then cleaved by angiotensin converting enzyme (ACE) to generate the physiologically active enzyme angiotensin II. The protein is involved in maintaining blood pressure and in the pathogenesis of essential hypertension and preeclampsia. Mutations in this gene are associated with susceptibility to essential hypertension, and can cause renal tubular dysgenesis, a severe disorder of renal tubular development. Defects in this gene have also been associated with non-familial structural atrial fibrillation, and inflammatory bowel disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this gene results in small body size and lower body fat, decreased blood pressure and hypotension, kidney abnormalities, polydipsia and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C A 7: 42,446,243 G194C possibly damaging Het
Adamtsl1 A G 4: 86,217,011 K258E probably damaging Het
Afdn A T 17: 13,810,445 D206V possibly damaging Het
Ankrd44 A T 1: 54,762,273 D298E probably damaging Het
Anks1 A G 17: 28,052,735 S897G probably benign Het
Apol9b A G 15: 77,735,546 probably null Het
Baz1a T C 12: 54,918,554 E705G probably benign Het
BC048679 C T 7: 81,495,218 V126M probably benign Het
Cep295 A G 9: 15,334,914 F749L possibly damaging Het
Cntrl T A 2: 35,128,024 I482K possibly damaging Het
Col6a3 A G 1: 90,822,233 F293S probably damaging Het
Dnah12 T G 14: 26,717,974 M527R probably damaging Het
Dnhd1 G A 7: 105,694,066 R1539H probably benign Het
Ece1 A G 4: 137,958,008 Y603C probably damaging Het
Eea1 G A 10: 96,041,473 A1350T possibly damaging Het
Exoc3l4 A T 12: 111,427,968 K507N possibly damaging Het
Fam126b T A 1: 58,529,875 Y515F probably damaging Het
Fam35a A G 14: 34,268,172 V259A probably benign Het
Flt3l A T 7: 45,133,667 probably null Het
Fn1 T C 1: 71,628,071 Q834R probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Ifih1 T C 2: 62,639,483 N157D possibly damaging Het
Itga2 A C 13: 114,843,473 M1064R probably benign Het
Itgae A G 11: 73,111,402 probably null Het
Krtap10-4 T C 10: 77,827,049 probably benign Het
Lamp3 A G 16: 19,699,681 C269R probably damaging Het
Lrp5 T C 19: 3,659,355 D125G probably damaging Het
Matn2 A C 15: 34,423,755 E586D probably benign Het
Mef2b T A 8: 70,164,139 probably null Het
Mrps22 A G 9: 98,601,471 probably null Het
Mtmr2 T C 9: 13,800,029 F445L probably damaging Het
Nxph4 A G 10: 127,526,368 V218A probably damaging Het
Olfr1308 C T 2: 111,960,746 G109D probably damaging Het
Olfr382 A G 11: 73,517,175 V8A probably benign Het
Olfr639 A G 7: 104,011,773 S310P probably benign Het
Pdpk1 A T 17: 24,106,922 V100D probably damaging Het
Phldb2 A C 16: 45,774,246 S899A probably benign Het
Pnpla3 G A 15: 84,172,782 probably null Het
Rasal2 A G 1: 157,299,187 Y94H probably damaging Het
Rlf A T 4: 121,148,822 I987N possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rprd2 A G 3: 95,780,441 Y300H probably damaging Het
Setbp1 G A 18: 78,783,369 S1343L probably benign Het
Sfswap A G 5: 129,571,041 K938E possibly damaging Het
Slc3a1 A C 17: 85,028,432 M1L probably damaging Het
Slco5a1 C T 1: 12,921,185 V427I probably benign Het
Ssbp2 A T 13: 91,690,908 M300L probably benign Het
Ssc5d A G 7: 4,937,522 D878G probably damaging Het
Stk19 A G 17: 34,824,598 L212P probably damaging Het
Stk39 T C 2: 68,410,043 M115V possibly damaging Het
Syt17 A C 7: 118,434,243 S181A probably benign Het
Taar7b A T 10: 23,999,951 N5Y probably benign Het
Tmc4 A G 7: 3,677,422 probably null Het
Tmem248 T A 5: 130,229,469 M1K probably null Het
Tmem82 T A 4: 141,616,410 Q183L probably damaging Het
Tpd52l1 T C 10: 31,338,207 E142G probably damaging Het
Ttll2 A T 17: 7,351,768 H253Q probably damaging Het
Ttn T C 2: 76,857,464 probably benign Het
Ubd A G 17: 37,195,501 K93E probably benign Het
Ugt2b35 T A 5: 87,001,556 F222Y probably damaging Het
Vmn2r10 G T 5: 109,003,462 N95K probably damaging Het
Vwa8 T C 14: 79,197,464 V1775A probably benign Het
Zdbf2 A G 1: 63,307,822 K1787E possibly damaging Het
Zfp26 A T 9: 20,437,286 F661I probably damaging Het
Zfp735 A T 11: 73,711,678 K483* probably null Het
Zfp946 A G 17: 22,454,538 E91G probably damaging Het
Zic5 C A 14: 122,459,749 D485Y unknown Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Agt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Agt APN 8 124557895 splice site probably benign
IGL01648:Agt APN 8 124564406 missense probably benign 0.01
IGL02145:Agt APN 8 124564448 missense probably damaging 0.99
IGL02929:Agt APN 8 124557090 missense probably benign
IGL02978:Agt APN 8 124557763 missense possibly damaging 0.93
IGL03207:Agt APN 8 124559368 missense probably damaging 0.98
R0518:Agt UTSW 8 124557100 nonsense probably null
R0521:Agt UTSW 8 124557100 nonsense probably null
R0562:Agt UTSW 8 124559275 missense probably benign 0.00
R0591:Agt UTSW 8 124556939 missense possibly damaging 0.77
R0646:Agt UTSW 8 124557113 missense probably damaging 1.00
R1495:Agt UTSW 8 124559455 missense probably damaging 1.00
R2568:Agt UTSW 8 124556955 missense probably damaging 1.00
R4750:Agt UTSW 8 124556937 missense probably benign
R4941:Agt UTSW 8 124556988 missense probably benign 0.32
R5782:Agt UTSW 8 124557131 splice site probably null
R5916:Agt UTSW 8 124563858 missense possibly damaging 0.70
R7769:Agt UTSW 8 124564550 missense probably benign 0.41
X0067:Agt UTSW 8 124556955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGAACTAGAGATGCCAAG -3'
(R):5'- AGCTGTGTCTTATGCACCCC -3'

Sequencing Primer
(F):5'- TGTTCCCCATGTCACTGGGAG -3'
(R):5'- GTGTCTTATGCACCCCCTTCC -3'
Posted On2018-04-27