Incidental Mutation 'R6332:Zfp26'
ID513179
Institutional Source Beutler Lab
Gene Symbol Zfp26
Ensembl Gene ENSMUSG00000063108
Gene Namezinc finger protein 26
SynonymsZfp70, KRAB15, Zfp81-rs1, Zfp-26, 5033428C05Rik, mkr-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6332 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20428449-20460162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20437286 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 661 (F661I)
Ref Sequence ENSEMBL: ENSMUSP00000124075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159569]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098970
Predicted Effect probably damaging
Transcript: ENSMUST00000159569
AA Change: F661I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124075
Gene: ENSMUSG00000063108
AA Change: F661I

DomainStartEndE-ValueType
Blast:KRAB 40 93 3e-6 BLAST
KRAB 107 167 4.28e-32 SMART
ZnF_C2H2 289 311 3.34e-2 SMART
ZnF_C2H2 344 366 3.63e-3 SMART
ZnF_C2H2 372 394 4.54e-4 SMART
ZnF_C2H2 400 422 2.65e-5 SMART
ZnF_C2H2 428 450 1.12e-3 SMART
ZnF_C2H2 456 478 9.08e-4 SMART
ZnF_C2H2 484 506 7.9e-4 SMART
ZnF_C2H2 512 534 2.43e-4 SMART
ZnF_C2H2 540 562 1.36e-2 SMART
ZnF_C2H2 568 590 3.44e-4 SMART
ZnF_C2H2 596 618 6.52e-5 SMART
ZnF_C2H2 624 646 2.32e-1 SMART
ZnF_C2H2 652 674 9.22e-5 SMART
ZnF_C2H2 680 702 1.22e-4 SMART
ZnF_C2H2 708 730 4.87e-4 SMART
ZnF_C2H2 736 758 4.54e-4 SMART
ZnF_C2H2 764 786 3.44e-4 SMART
ZnF_C2H2 792 814 5.21e-4 SMART
ZnF_C2H2 820 842 3.44e-4 SMART
ZnF_C2H2 848 870 5.14e-3 SMART
ZnF_C2H2 876 898 2.79e-4 SMART
ZnF_C2H2 904 926 2.12e-4 SMART
ZnF_C2H2 932 954 9.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180846
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the krueppel C2H2-type zinc-finger protein family, and it contains one KRAB domain and eighteen C2H2-type zinc fingers. This gene is a candidate gene for autism and variable cognitive impairment in the 16q24.3 microdeletion syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C A 7: 42,446,243 G194C possibly damaging Het
Adamtsl1 A G 4: 86,217,011 K258E probably damaging Het
Afdn A T 17: 13,810,445 D206V possibly damaging Het
Agt G T 8: 124,557,833 Q389K possibly damaging Het
Ankrd44 A T 1: 54,762,273 D298E probably damaging Het
Anks1 A G 17: 28,052,735 S897G probably benign Het
Apol9b A G 15: 77,735,546 probably null Het
Baz1a T C 12: 54,918,554 E705G probably benign Het
BC048679 C T 7: 81,495,218 V126M probably benign Het
Cep295 A G 9: 15,334,914 F749L possibly damaging Het
Cntrl T A 2: 35,128,024 I482K possibly damaging Het
Col6a3 A G 1: 90,822,233 F293S probably damaging Het
Dnah12 T G 14: 26,717,974 M527R probably damaging Het
Dnhd1 G A 7: 105,694,066 R1539H probably benign Het
Ece1 A G 4: 137,958,008 Y603C probably damaging Het
Eea1 G A 10: 96,041,473 A1350T possibly damaging Het
Exoc3l4 A T 12: 111,427,968 K507N possibly damaging Het
Fam126b T A 1: 58,529,875 Y515F probably damaging Het
Fam35a A G 14: 34,268,172 V259A probably benign Het
Flt3l A T 7: 45,133,667 probably null Het
Fn1 T C 1: 71,628,071 Q834R probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Ifih1 T C 2: 62,639,483 N157D possibly damaging Het
Itga2 A C 13: 114,843,473 M1064R probably benign Het
Itgae A G 11: 73,111,402 probably null Het
Krtap10-4 T C 10: 77,827,049 probably benign Het
Lamp3 A G 16: 19,699,681 C269R probably damaging Het
Lrp5 T C 19: 3,659,355 D125G probably damaging Het
Matn2 A C 15: 34,423,755 E586D probably benign Het
Mef2b T A 8: 70,164,139 probably null Het
Mrps22 A G 9: 98,601,471 probably null Het
Mtmr2 T C 9: 13,800,029 F445L probably damaging Het
Nxph4 A G 10: 127,526,368 V218A probably damaging Het
Olfr1308 C T 2: 111,960,746 G109D probably damaging Het
Olfr382 A G 11: 73,517,175 V8A probably benign Het
Olfr639 A G 7: 104,011,773 S310P probably benign Het
Pdpk1 A T 17: 24,106,922 V100D probably damaging Het
Phldb2 A C 16: 45,774,246 S899A probably benign Het
Pnpla3 G A 15: 84,172,782 probably null Het
Rasal2 A G 1: 157,299,187 Y94H probably damaging Het
Rlf A T 4: 121,148,822 I987N possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rprd2 A G 3: 95,780,441 Y300H probably damaging Het
Setbp1 G A 18: 78,783,369 S1343L probably benign Het
Sfswap A G 5: 129,571,041 K938E possibly damaging Het
Slc3a1 A C 17: 85,028,432 M1L probably damaging Het
Slco5a1 C T 1: 12,921,185 V427I probably benign Het
Ssbp2 A T 13: 91,690,908 M300L probably benign Het
Ssc5d A G 7: 4,937,522 D878G probably damaging Het
Stk19 A G 17: 34,824,598 L212P probably damaging Het
Stk39 T C 2: 68,410,043 M115V possibly damaging Het
Syt17 A C 7: 118,434,243 S181A probably benign Het
Taar7b A T 10: 23,999,951 N5Y probably benign Het
Tmc4 A G 7: 3,677,422 probably null Het
Tmem248 T A 5: 130,229,469 M1K probably null Het
Tmem82 T A 4: 141,616,410 Q183L probably damaging Het
Tpd52l1 T C 10: 31,338,207 E142G probably damaging Het
Ttll2 A T 17: 7,351,768 H253Q probably damaging Het
Ttn T C 2: 76,857,464 probably benign Het
Ubd A G 17: 37,195,501 K93E probably benign Het
Ugt2b35 T A 5: 87,001,556 F222Y probably damaging Het
Vmn2r10 G T 5: 109,003,462 N95K probably damaging Het
Vwa8 T C 14: 79,197,464 V1775A probably benign Het
Zdbf2 A G 1: 63,307,822 K1787E possibly damaging Het
Zfp735 A T 11: 73,711,678 K483* probably null Het
Zfp946 A G 17: 22,454,538 E91G probably damaging Het
Zic5 C A 14: 122,459,749 D485Y unknown Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Zfp26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Zfp26 APN 9 20439548 missense possibly damaging 0.68
IGL02273:Zfp26 APN 9 20441448 missense probably damaging 0.96
FR4449:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4548:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4737:Zfp26 UTSW 9 20438546 missense probably benign 0.01
FR4976:Zfp26 UTSW 9 20438546 missense probably benign 0.01
LCD18:Zfp26 UTSW 9 20438546 missense probably benign 0.01
R0157:Zfp26 UTSW 9 20437870 missense probably benign 0.37
R1591:Zfp26 UTSW 9 20437625 missense probably benign 0.01
R1818:Zfp26 UTSW 9 20442191 missense probably benign 0.00
R1936:Zfp26 UTSW 9 20437553 missense probably benign 0.04
R2081:Zfp26 UTSW 9 20436617 missense probably benign 0.17
R2107:Zfp26 UTSW 9 20442237 missense probably benign
R2240:Zfp26 UTSW 9 20437267 missense probably damaging 1.00
R3429:Zfp26 UTSW 9 20441460 unclassified probably benign
R3785:Zfp26 UTSW 9 20437802 missense probably damaging 1.00
R4050:Zfp26 UTSW 9 20442229 missense probably benign
R4198:Zfp26 UTSW 9 20436716 missense probably benign 0.17
R4200:Zfp26 UTSW 9 20436716 missense probably benign 0.17
R4360:Zfp26 UTSW 9 20438573 missense probably benign 0.35
R4505:Zfp26 UTSW 9 20442265 missense probably benign 0.29
R5171:Zfp26 UTSW 9 20444907 missense probably benign
R5412:Zfp26 UTSW 9 20438239 missense possibly damaging 0.75
R5493:Zfp26 UTSW 9 20444319 missense possibly damaging 0.66
R5576:Zfp26 UTSW 9 20437507 missense possibly damaging 0.86
R5652:Zfp26 UTSW 9 20437841 nonsense probably null
R6089:Zfp26 UTSW 9 20437693 missense probably damaging 0.99
R7599:Zfp26 UTSW 9 20437833 missense probably damaging 1.00
R7713:Zfp26 UTSW 9 20441334 missense probably benign 0.08
X0065:Zfp26 UTSW 9 20436891 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTTACACTGAAAGGGTCTCTC -3'
(R):5'- AGAAATTCCTCATGCCTTAAGACTC -3'

Sequencing Primer
(F):5'- CACTGAAAGGGTCTCTCAGAACTATG -3'
(R):5'- TACTGTGGGAAAGCCTTCAC -3'
Posted On2018-04-27