Incidental Mutation 'R6332:Itgae'
ID513186
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Nameintegrin alpha E, epithelial-associated
SynonymsCD103, alpha-E1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6332 (G1)
Quality Score163.009
Status Validated
Chromosome11
Chromosomal Location73090583-73147446 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 73111402 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
Predicted Effect probably null
Transcript: ENSMUST00000006101
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102537
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C A 7: 42,446,243 G194C possibly damaging Het
Adamtsl1 A G 4: 86,217,011 K258E probably damaging Het
Afdn A T 17: 13,810,445 D206V possibly damaging Het
Agt G T 8: 124,557,833 Q389K possibly damaging Het
Ankrd44 A T 1: 54,762,273 D298E probably damaging Het
Anks1 A G 17: 28,052,735 S897G probably benign Het
Apol9b A G 15: 77,735,546 probably null Het
Baz1a T C 12: 54,918,554 E705G probably benign Het
BC048679 C T 7: 81,495,218 V126M probably benign Het
Cep295 A G 9: 15,334,914 F749L possibly damaging Het
Cntrl T A 2: 35,128,024 I482K possibly damaging Het
Col6a3 A G 1: 90,822,233 F293S probably damaging Het
Dnah12 T G 14: 26,717,974 M527R probably damaging Het
Dnhd1 G A 7: 105,694,066 R1539H probably benign Het
Ece1 A G 4: 137,958,008 Y603C probably damaging Het
Eea1 G A 10: 96,041,473 A1350T possibly damaging Het
Exoc3l4 A T 12: 111,427,968 K507N possibly damaging Het
Fam126b T A 1: 58,529,875 Y515F probably damaging Het
Fam35a A G 14: 34,268,172 V259A probably benign Het
Flt3l A T 7: 45,133,667 probably null Het
Fn1 T C 1: 71,628,071 Q834R probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Ifih1 T C 2: 62,639,483 N157D possibly damaging Het
Itga2 A C 13: 114,843,473 M1064R probably benign Het
Krtap10-4 T C 10: 77,827,049 probably benign Het
Lamp3 A G 16: 19,699,681 C269R probably damaging Het
Lrp5 T C 19: 3,659,355 D125G probably damaging Het
Matn2 A C 15: 34,423,755 E586D probably benign Het
Mef2b T A 8: 70,164,139 probably null Het
Mrps22 A G 9: 98,601,471 probably null Het
Mtmr2 T C 9: 13,800,029 F445L probably damaging Het
Nxph4 A G 10: 127,526,368 V218A probably damaging Het
Olfr1308 C T 2: 111,960,746 G109D probably damaging Het
Olfr382 A G 11: 73,517,175 V8A probably benign Het
Olfr639 A G 7: 104,011,773 S310P probably benign Het
Pdpk1 A T 17: 24,106,922 V100D probably damaging Het
Phldb2 A C 16: 45,774,246 S899A probably benign Het
Pnpla3 G A 15: 84,172,782 probably null Het
Rasal2 A G 1: 157,299,187 Y94H probably damaging Het
Rlf A T 4: 121,148,822 I987N possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rprd2 A G 3: 95,780,441 Y300H probably damaging Het
Setbp1 G A 18: 78,783,369 S1343L probably benign Het
Sfswap A G 5: 129,571,041 K938E possibly damaging Het
Slc3a1 A C 17: 85,028,432 M1L probably damaging Het
Slco5a1 C T 1: 12,921,185 V427I probably benign Het
Ssbp2 A T 13: 91,690,908 M300L probably benign Het
Ssc5d A G 7: 4,937,522 D878G probably damaging Het
Stk19 A G 17: 34,824,598 L212P probably damaging Het
Stk39 T C 2: 68,410,043 M115V possibly damaging Het
Syt17 A C 7: 118,434,243 S181A probably benign Het
Taar7b A T 10: 23,999,951 N5Y probably benign Het
Tmc4 A G 7: 3,677,422 probably null Het
Tmem248 T A 5: 130,229,469 M1K probably null Het
Tmem82 T A 4: 141,616,410 Q183L probably damaging Het
Tpd52l1 T C 10: 31,338,207 E142G probably damaging Het
Ttll2 A T 17: 7,351,768 H253Q probably damaging Het
Ttn T C 2: 76,857,464 probably benign Het
Ubd A G 17: 37,195,501 K93E probably benign Het
Ugt2b35 T A 5: 87,001,556 F222Y probably damaging Het
Vmn2r10 G T 5: 109,003,462 N95K probably damaging Het
Vwa8 T C 14: 79,197,464 V1775A probably benign Het
Zdbf2 A G 1: 63,307,822 K1787E possibly damaging Het
Zfp26 A T 9: 20,437,286 F661I probably damaging Het
Zfp735 A T 11: 73,711,678 K483* probably null Het
Zfp946 A G 17: 22,454,538 E91G probably damaging Het
Zic5 C A 14: 122,459,749 D485Y unknown Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73145635 missense probably benign 0.17
IGL00472:Itgae APN 11 73113694 missense probably benign 0.06
IGL00821:Itgae APN 11 73123148 missense probably damaging 1.00
IGL01625:Itgae APN 11 73119437 missense probably benign 0.00
IGL01639:Itgae APN 11 73119378 missense probably benign 0.00
IGL01743:Itgae APN 11 73111759 missense probably benign 0.02
IGL01911:Itgae APN 11 73116137 missense probably damaging 1.00
IGL01949:Itgae APN 11 73118184 missense probably benign 0.29
IGL02149:Itgae APN 11 73103894 missense probably benign 0.04
IGL02179:Itgae APN 11 73134018 missense probably benign 0.06
IGL02231:Itgae APN 11 73090622 missense possibly damaging 0.88
IGL02292:Itgae APN 11 73118535 missense probably damaging 0.98
IGL02378:Itgae APN 11 73118121 missense probably benign 0.00
IGL02525:Itgae APN 11 73130951 missense probably damaging 0.98
IGL02576:Itgae APN 11 73118505 missense possibly damaging 0.95
IGL02729:Itgae APN 11 73118203 splice site probably benign
IGL02859:Itgae APN 11 73114867 missense probably damaging 1.00
IGL03074:Itgae APN 11 73125310 missense probably benign 0.00
IGL03107:Itgae APN 11 73113601 missense probably damaging 1.00
IGL03264:Itgae APN 11 73115574 missense possibly damaging 0.73
IGL03272:Itgae APN 11 73133854 splice site probably null
IGL03352:Itgae APN 11 73131730 missense probably damaging 1.00
R0134:Itgae UTSW 11 73111342 missense probably benign 0.00
R0225:Itgae UTSW 11 73111342 missense probably benign 0.00
R0320:Itgae UTSW 11 73130999 missense possibly damaging 0.74
R0344:Itgae UTSW 11 73118147 missense probably benign 0.13
R0403:Itgae UTSW 11 73123183 missense possibly damaging 0.89
R0631:Itgae UTSW 11 73114907 missense probably damaging 1.00
R0833:Itgae UTSW 11 73129206 missense probably benign 0.02
R0836:Itgae UTSW 11 73129206 missense probably benign 0.02
R0973:Itgae UTSW 11 73138509 nonsense probably null
R1231:Itgae UTSW 11 73119379 missense probably benign 0.02
R1389:Itgae UTSW 11 73125362 missense probably damaging 1.00
R1433:Itgae UTSW 11 73115592 missense probably damaging 1.00
R1534:Itgae UTSW 11 73145605 missense possibly damaging 0.58
R1833:Itgae UTSW 11 73117162 missense possibly damaging 0.94
R1914:Itgae UTSW 11 73118643 splice site probably benign
R1915:Itgae UTSW 11 73118643 splice site probably benign
R2061:Itgae UTSW 11 73118622 missense probably benign 0.00
R2380:Itgae UTSW 11 73145569 missense probably benign 0.00
R2435:Itgae UTSW 11 73121937 nonsense probably null
R2680:Itgae UTSW 11 73114926 missense probably damaging 1.00
R2886:Itgae UTSW 11 73140687 missense probably benign 0.04
R3873:Itgae UTSW 11 73113616 missense probably damaging 1.00
R3923:Itgae UTSW 11 73116143 missense probably damaging 0.99
R4010:Itgae UTSW 11 73111339 missense probably benign 0.00
R4059:Itgae UTSW 11 73112134 missense probably benign
R4212:Itgae UTSW 11 73119352 missense probably benign
R4213:Itgae UTSW 11 73119352 missense probably benign
R4691:Itgae UTSW 11 73119519 nonsense probably null
R4736:Itgae UTSW 11 73114880 missense possibly damaging 0.79
R5152:Itgae UTSW 11 73130995 missense probably damaging 1.00
R5201:Itgae UTSW 11 73110556 missense probably benign 0.00
R5307:Itgae UTSW 11 73145638 missense probably benign 0.00
R5362:Itgae UTSW 11 73111849 missense probably damaging 1.00
R5448:Itgae UTSW 11 73133908 critical splice donor site probably null
R5645:Itgae UTSW 11 73129248 missense probably damaging 1.00
R5672:Itgae UTSW 11 73145551 missense possibly damaging 0.96
R6079:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6138:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6226:Itgae UTSW 11 73140757 missense probably benign 0.11
R6244:Itgae UTSW 11 73145601 missense probably damaging 0.96
R6326:Itgae UTSW 11 73131693 missense possibly damaging 0.88
R6502:Itgae UTSW 11 73145592 missense probably benign 0.10
R6825:Itgae UTSW 11 73118496 missense possibly damaging 0.89
R7016:Itgae UTSW 11 73119516 missense probably damaging 0.99
R7020:Itgae UTSW 11 73111369 missense probably damaging 1.00
R7069:Itgae UTSW 11 73116143 missense probably damaging 0.99
R7132:Itgae UTSW 11 73111358 missense possibly damaging 0.93
R7473:Itgae UTSW 11 73140678 missense possibly damaging 0.87
R7599:Itgae UTSW 11 73121960 missense possibly damaging 0.62
R7637:Itgae UTSW 11 73113631 missense probably damaging 1.00
R7763:Itgae UTSW 11 73123269 critical splice donor site probably null
R7829:Itgae UTSW 11 73138792 missense probably benign
R7860:Itgae UTSW 11 73120273 critical splice acceptor site probably null
R7978:Itgae UTSW 11 73134087 missense probably damaging 0.98
R8197:Itgae UTSW 11 73120384 missense probably benign
U15987:Itgae UTSW 11 73115574 missense possibly damaging 0.73
X0024:Itgae UTSW 11 73111376 missense probably benign 0.01
Z1186:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1186:Itgae UTSW 11 73115640 missense probably benign
Z1186:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1186:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1186:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1186:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1187:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1187:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1187:Itgae UTSW 11 73115640 missense probably benign
Z1187:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1187:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1187:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1187:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1188:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1188:Itgae UTSW 11 73115640 missense probably benign
Z1188:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1188:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1188:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1188:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1189:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1189:Itgae UTSW 11 73115640 missense probably benign
Z1189:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1189:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1189:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1189:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1190:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1190:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1190:Itgae UTSW 11 73115640 missense probably benign
Z1190:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1190:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1190:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1190:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1191:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1191:Itgae UTSW 11 73115640 missense probably benign
Z1191:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1191:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1191:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1191:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1192:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1192:Itgae UTSW 11 73115640 missense probably benign
Z1192:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1192:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1192:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1192:Itgae UTSW 11 73134127 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TCAGGTCCATGGAACCTCTAAC -3'
(R):5'- GGTCAGATATCAGGTGCTGGAG -3'

Sequencing Primer
(F):5'- GGTCCATGGAACCTCTAACTCTAG -3'
(R):5'- TGCTGGAGTCAGAAATGCAGTC -3'
Posted On2018-04-27