Incidental Mutation 'R6332:Lamp3'
ID513201
Institutional Source Beutler Lab
Gene Symbol Lamp3
Ensembl Gene ENSMUSG00000041247
Gene Namelysosomal-associated membrane protein 3
SynonymsCd208, DC-LAMP, 1200002D17Rik, TSC403
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6332 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location19653378-19706375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19699681 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 269 (C269R)
Ref Sequence ENSEMBL: ENSMUSP00000080556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081880]
Predicted Effect probably damaging
Transcript: ENSMUST00000081880
AA Change: C269R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080556
Gene: ENSMUSG00000041247
AA Change: C269R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Lamp 103 411 5.6e-75 PFAM
Meta Mutation Damage Score 0.9516 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dendritic cells (DCs) are the most potent antigen-presenting cells. Immature DCs efficiently capture antigens and differentiate into interdigitating dendritic cells (IDCs) in lymphoid tissues that induce primary T-cell responses (summary by de Saint-Vis et al., 1998 [PubMed 9768752]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C A 7: 42,446,243 G194C possibly damaging Het
Adamtsl1 A G 4: 86,217,011 K258E probably damaging Het
Afdn A T 17: 13,810,445 D206V possibly damaging Het
Agt G T 8: 124,557,833 Q389K possibly damaging Het
Ankrd44 A T 1: 54,762,273 D298E probably damaging Het
Anks1 A G 17: 28,052,735 S897G probably benign Het
Apol9b A G 15: 77,735,546 probably null Het
Baz1a T C 12: 54,918,554 E705G probably benign Het
BC048679 C T 7: 81,495,218 V126M probably benign Het
Cep295 A G 9: 15,334,914 F749L possibly damaging Het
Cntrl T A 2: 35,128,024 I482K possibly damaging Het
Col6a3 A G 1: 90,822,233 F293S probably damaging Het
Dnah12 T G 14: 26,717,974 M527R probably damaging Het
Dnhd1 G A 7: 105,694,066 R1539H probably benign Het
Ece1 A G 4: 137,958,008 Y603C probably damaging Het
Eea1 G A 10: 96,041,473 A1350T possibly damaging Het
Exoc3l4 A T 12: 111,427,968 K507N possibly damaging Het
Fam126b T A 1: 58,529,875 Y515F probably damaging Het
Fam35a A G 14: 34,268,172 V259A probably benign Het
Flt3l A T 7: 45,133,667 probably null Het
Fn1 T C 1: 71,628,071 Q834R probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Ifih1 T C 2: 62,639,483 N157D possibly damaging Het
Itga2 A C 13: 114,843,473 M1064R probably benign Het
Itgae A G 11: 73,111,402 probably null Het
Krtap10-4 T C 10: 77,827,049 probably benign Het
Lrp5 T C 19: 3,659,355 D125G probably damaging Het
Matn2 A C 15: 34,423,755 E586D probably benign Het
Mef2b T A 8: 70,164,139 probably null Het
Mrps22 A G 9: 98,601,471 probably null Het
Mtmr2 T C 9: 13,800,029 F445L probably damaging Het
Nxph4 A G 10: 127,526,368 V218A probably damaging Het
Olfr1308 C T 2: 111,960,746 G109D probably damaging Het
Olfr382 A G 11: 73,517,175 V8A probably benign Het
Olfr639 A G 7: 104,011,773 S310P probably benign Het
Pdpk1 A T 17: 24,106,922 V100D probably damaging Het
Phldb2 A C 16: 45,774,246 S899A probably benign Het
Pnpla3 G A 15: 84,172,782 probably null Het
Rasal2 A G 1: 157,299,187 Y94H probably damaging Het
Rlf A T 4: 121,148,822 I987N possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rprd2 A G 3: 95,780,441 Y300H probably damaging Het
Setbp1 G A 18: 78,783,369 S1343L probably benign Het
Sfswap A G 5: 129,571,041 K938E possibly damaging Het
Slc3a1 A C 17: 85,028,432 M1L probably damaging Het
Slco5a1 C T 1: 12,921,185 V427I probably benign Het
Ssbp2 A T 13: 91,690,908 M300L probably benign Het
Ssc5d A G 7: 4,937,522 D878G probably damaging Het
Stk19 A G 17: 34,824,598 L212P probably damaging Het
Stk39 T C 2: 68,410,043 M115V possibly damaging Het
Syt17 A C 7: 118,434,243 S181A probably benign Het
Taar7b A T 10: 23,999,951 N5Y probably benign Het
Tmc4 A G 7: 3,677,422 probably null Het
Tmem248 T A 5: 130,229,469 M1K probably null Het
Tmem82 T A 4: 141,616,410 Q183L probably damaging Het
Tpd52l1 T C 10: 31,338,207 E142G probably damaging Het
Ttll2 A T 17: 7,351,768 H253Q probably damaging Het
Ttn T C 2: 76,857,464 probably benign Het
Ubd A G 17: 37,195,501 K93E probably benign Het
Ugt2b35 T A 5: 87,001,556 F222Y probably damaging Het
Vmn2r10 G T 5: 109,003,462 N95K probably damaging Het
Vwa8 T C 14: 79,197,464 V1775A probably benign Het
Zdbf2 A G 1: 63,307,822 K1787E possibly damaging Het
Zfp26 A T 9: 20,437,286 F661I probably damaging Het
Zfp735 A T 11: 73,711,678 K483* probably null Het
Zfp946 A G 17: 22,454,538 E91G probably damaging Het
Zic5 C A 14: 122,459,749 D485Y unknown Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Lamp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Lamp3 APN 16 19673419 missense probably damaging 1.00
IGL02505:Lamp3 APN 16 19655457 missense possibly damaging 0.48
IGL02892:Lamp3 APN 16 19676052 missense probably damaging 1.00
IGL03228:Lamp3 APN 16 19676067 missense possibly damaging 0.94
PIT4453001:Lamp3 UTSW 16 19673460 missense probably benign 0.14
R0295:Lamp3 UTSW 16 19701108 nonsense probably null
R0419:Lamp3 UTSW 16 19673552 missense probably damaging 1.00
R1568:Lamp3 UTSW 16 19673525 missense probably damaging 1.00
R1702:Lamp3 UTSW 16 19676072 missense probably benign 0.11
R2018:Lamp3 UTSW 16 19701211 missense probably benign 0.02
R2019:Lamp3 UTSW 16 19701211 missense probably benign 0.02
R4072:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4073:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4075:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4076:Lamp3 UTSW 16 19700716 missense possibly damaging 0.89
R4333:Lamp3 UTSW 16 19673436 missense probably benign 0.02
R4457:Lamp3 UTSW 16 19673529 missense probably benign 0.19
R4868:Lamp3 UTSW 16 19701290 missense probably benign 0.01
R4876:Lamp3 UTSW 16 19655470 missense probably damaging 0.97
R5766:Lamp3 UTSW 16 19701317 missense probably damaging 0.99
R5832:Lamp3 UTSW 16 19701320 missense probably damaging 0.98
R5997:Lamp3 UTSW 16 19701028 missense probably benign 0.22
R6000:Lamp3 UTSW 16 19700948 missense possibly damaging 0.88
R6088:Lamp3 UTSW 16 19673398 missense probably damaging 1.00
R6636:Lamp3 UTSW 16 19701233 missense probably benign
R6637:Lamp3 UTSW 16 19701233 missense probably benign
R6881:Lamp3 UTSW 16 19699618 missense probably benign 0.39
R6966:Lamp3 UTSW 16 19699653 nonsense probably null
R7002:Lamp3 UTSW 16 19655422 missense possibly damaging 0.89
R7067:Lamp3 UTSW 16 19699663 missense probably damaging 0.99
R7425:Lamp3 UTSW 16 19699612 critical splice donor site probably null
R7781:Lamp3 UTSW 16 19699690 missense possibly damaging 0.86
R7866:Lamp3 UTSW 16 19699740 missense probably benign 0.01
R7894:Lamp3 UTSW 16 19655391 missense probably damaging 1.00
R7912:Lamp3 UTSW 16 19655497 missense probably damaging 1.00
R7949:Lamp3 UTSW 16 19699740 missense probably benign 0.01
R7977:Lamp3 UTSW 16 19655391 missense probably damaging 1.00
R7993:Lamp3 UTSW 16 19655497 missense probably damaging 1.00
R8036:Lamp3 UTSW 16 19701059 missense probably damaging 1.00
RF018:Lamp3 UTSW 16 19701250 missense probably benign
X0025:Lamp3 UTSW 16 19701056 missense possibly damaging 0.82
X0063:Lamp3 UTSW 16 19700885 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGCTAATTCTGACAGGATCTAGC -3'
(R):5'- TGTCACACAATTGGGGAGTTTG -3'

Sequencing Primer
(F):5'- GGATCTAGCTTGAAATTTAGCACTG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2018-04-27