Incidental Mutation 'R6333:Trmt1l'
ID513215
Institutional Source Beutler Lab
Gene Symbol Trmt1l
Ensembl Gene ENSMUSG00000053286
Gene NametRNA methyltransferase 1 like
SynonymsTrm1-like, 1190005F20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6333 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location151428542-151458161 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 151453934 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 543 (S543T)
Ref Sequence ENSEMBL: ENSMUSP00000068309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065625] [ENSMUST00000189655] [ENSMUST00000190070]
Predicted Effect probably benign
Transcript: ENSMUST00000065625
AA Change: S543T

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: S543T

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188843
Predicted Effect probably benign
Transcript: ENSMUST00000189655
SMART Domains Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
ZnF_C2H2 28 50 1.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190070
SMART Domains Protein: ENSMUSP00000139676
Gene: ENSMUSG00000026484

DomainStartEndE-ValueType
Blast:RING 1 35 7e-16 BLAST
PDB:3H8H|A 73 156 2e-56 PDB
Meta Mutation Damage Score 0.2776 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 97.9%
  • 20x: 93.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik T C 9: 15,292,076 K111R probably benign Het
Abhd18 A G 3: 40,933,783 Y354C probably benign Het
Acap1 T C 11: 69,883,601 I424V possibly damaging Het
AI182371 A T 2: 35,085,269 I306K probably damaging Het
Asb4 G A 6: 5,423,597 R248H probably damaging Het
Brd7 T C 8: 88,345,191 T349A probably damaging Het
Bub1b T C 2: 118,598,463 probably null Het
Cep85l G A 10: 53,349,101 Q131* probably null Het
Chmp2b T A 16: 65,540,250 M178L possibly damaging Het
Chrnb3 A G 8: 27,393,327 N84D probably damaging Het
Clec4b2 A T 6: 123,200,678 probably null Het
Defa34 T C 8: 21,665,846 V17A probably benign Het
Dnah3 A T 7: 120,054,633 L947Q probably damaging Het
Ell A G 8: 70,591,538 Y578C probably damaging Het
Esp36 T A 17: 38,417,244 M49L probably benign Het
Fam35a G A 14: 34,267,608 T447M probably damaging Het
Fbxw19 A T 9: 109,494,683 W75R probably benign Het
Fcgr4 A G 1: 171,029,269 Y235C probably damaging Het
Gm10110 A C 14: 89,898,297 noncoding transcript Het
Gm13030 A T 4: 138,871,397 probably null Het
Gm9733 T C 3: 15,320,611 Y77C probably damaging Het
Hdac9 T C 12: 34,052,324 M1058V probably damaging Het
Hsd3b6 A G 3: 98,806,224 F253S probably damaging Het
Hspg2 T C 4: 137,561,955 Y3794H probably damaging Het
Mark4 G A 7: 19,443,283 T207M probably damaging Het
Mme A G 3: 63,341,961 T304A probably benign Het
Neb A G 2: 52,258,263 L2657P probably damaging Het
Nufip1 A C 14: 76,111,985 K152N probably damaging Het
Papd4 G A 13: 93,186,313 Q43* probably null Het
Pcdh1 A G 18: 38,198,807 V381A probably benign Het
Pdss1 A G 2: 22,901,766 T30A probably damaging Het
Plrg1 A G 3: 83,056,795 T12A probably damaging Het
Ppig C T 2: 69,749,558 H479Y unknown Het
Prokr2 A G 2: 132,373,978 F188L probably damaging Het
Prss39 A G 1: 34,500,069 N130S probably benign Het
Ptar1 G A 19: 23,694,322 D30N possibly damaging Het
Rai14 G T 15: 10,574,936 Y645* probably null Het
Rnasek T C 11: 70,238,426 Y67C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,463,366 V4023A probably damaging Het
Sash3 C T X: 48,159,521 L307F probably damaging Homo
Sctr T C 1: 120,056,452 F357L probably damaging Het
Sec14l5 G A 16: 5,167,044 V85I probably benign Het
Spag8 T C 4: 43,653,186 probably benign Het
Tbc1d2 T C 4: 46,620,736 D358G possibly damaging Het
Tcte3 G A 17: 15,041,455 probably benign Het
Tenm4 A G 7: 96,774,124 T672A probably damaging Het
Ube4b A G 4: 149,348,037 F810S probably damaging Het
Vmn2r104 C T 17: 20,029,586 V808I probably benign Het
Zfp3 T A 11: 70,771,440 I75N probably benign Het
Zwint A G 10: 72,654,952 probably benign Het
Other mutations in Trmt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Trmt1l APN 1 151442712 critical splice donor site probably null
IGL02175:Trmt1l APN 1 151448484 missense probably benign 0.00
IGL02348:Trmt1l APN 1 151450006 missense probably damaging 1.00
IGL02397:Trmt1l APN 1 151439531 missense probably damaging 1.00
IGL02582:Trmt1l APN 1 151433785 splice site probably benign
IGL03150:Trmt1l APN 1 151453892 missense probably benign 0.00
IGL03220:Trmt1l APN 1 151440941 splice site probably benign
Canyonlands UTSW 1 151454048 nonsense probably null
IGL03014:Trmt1l UTSW 1 151457930 missense probably damaging 0.99
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0067:Trmt1l UTSW 1 151448380 missense probably benign 0.16
R0240:Trmt1l UTSW 1 151457454 unclassified probably benign
R0267:Trmt1l UTSW 1 151457675 unclassified probably benign
R2084:Trmt1l UTSW 1 151440854 missense probably damaging 1.00
R2206:Trmt1l UTSW 1 151435843 critical splice donor site probably null
R2338:Trmt1l UTSW 1 151428959 intron probably benign
R2408:Trmt1l UTSW 1 151439516 missense possibly damaging 0.48
R2429:Trmt1l UTSW 1 151433830 missense probably damaging 1.00
R2520:Trmt1l UTSW 1 151453945 missense probably benign 0.14
R3972:Trmt1l UTSW 1 151433883 missense possibly damaging 0.91
R4092:Trmt1l UTSW 1 151455033 missense probably benign 0.18
R4361:Trmt1l UTSW 1 151435875 intron probably benign
R4411:Trmt1l UTSW 1 151452154 missense probably benign 0.02
R4419:Trmt1l UTSW 1 151440808 missense probably damaging 0.98
R4518:Trmt1l UTSW 1 151448343 nonsense probably null
R4614:Trmt1l UTSW 1 151454048 nonsense probably null
R4617:Trmt1l UTSW 1 151454048 nonsense probably null
R4618:Trmt1l UTSW 1 151454048 nonsense probably null
R4647:Trmt1l UTSW 1 151457881 missense possibly damaging 0.86
R4653:Trmt1l UTSW 1 151439569 missense probably benign 0.00
R4734:Trmt1l UTSW 1 151442637 missense probably benign 0.32
R4873:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R4875:Trmt1l UTSW 1 151455004 missense probably benign 0.04
R5026:Trmt1l UTSW 1 151440876 missense probably damaging 1.00
R5528:Trmt1l UTSW 1 151454995 missense probably benign
R5587:Trmt1l UTSW 1 151435704 intron probably benign
R5872:Trmt1l UTSW 1 151440843 missense probably damaging 1.00
R6060:Trmt1l UTSW 1 151457580 missense possibly damaging 0.78
R6169:Trmt1l UTSW 1 151428953 intron probably benign
R6906:Trmt1l UTSW 1 151452175 missense probably benign 0.03
R7269:Trmt1l UTSW 1 151457788 missense possibly damaging 0.81
R7574:Trmt1l UTSW 1 151440840 missense possibly damaging 0.95
R7740:Trmt1l UTSW 1 151440888 missense possibly damaging 0.47
R7760:Trmt1l UTSW 1 151442674 missense possibly damaging 0.93
X0039:Trmt1l UTSW 1 151454990 missense possibly damaging 0.88
Z1176:Trmt1l UTSW 1 151453113 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CCTGATTTTCAGTATTATTCTAGCCC -3'
(R):5'- CACTAAGAAGGGTTACTTAAAGCATAT -3'

Sequencing Primer
(F):5'- TTCCAAAGGTCCGGAGTTCAAATC -3'
(R):5'- GCATGAGTTGAACACTGG -3'
Posted On2018-04-27