Incidental Mutation 'R6333:Tenm4'
ID 513235
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Name teneurin transmembrane protein 4
Synonyms l7Rn3, Doc4, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission 044487-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6333 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 95820453-96560300 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96423331 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 672 (T672A)
Ref Sequence ENSEMBL: ENSMUSP00000102784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107162
AA Change: T717A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: T717A

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107165
AA Change: T709A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: T709A

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107166
AA Change: T672A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: T672A

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140140
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 97.9%
  • 20x: 93.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik T C 9: 15,203,372 (GRCm39) K111R probably benign Het
Abhd18 A G 3: 40,888,218 (GRCm39) Y354C probably benign Het
Acap1 T C 11: 69,774,427 (GRCm39) I424V possibly damaging Het
AI182371 A T 2: 34,975,281 (GRCm39) I306K probably damaging Het
Asb4 G A 6: 5,423,597 (GRCm39) R248H probably damaging Het
Brd7 T C 8: 89,071,819 (GRCm39) T349A probably damaging Het
Bub1b T C 2: 118,428,944 (GRCm39) probably null Het
Cep85l G A 10: 53,225,197 (GRCm39) Q131* probably null Het
Chmp2b T A 16: 65,337,136 (GRCm39) M178L possibly damaging Het
Chrnb3 A G 8: 27,883,355 (GRCm39) N84D probably damaging Het
Clec4b2 A T 6: 123,177,637 (GRCm39) probably null Het
Defa34 T C 8: 22,155,862 (GRCm39) V17A probably benign Het
Dnah3 A T 7: 119,653,856 (GRCm39) L947Q probably damaging Het
Dynlt2a1 G A 17: 15,261,717 (GRCm39) probably benign Het
Ell A G 8: 71,044,188 (GRCm39) Y578C probably damaging Het
Esp36 T A 17: 38,728,135 (GRCm39) M49L probably benign Het
Fbxw19 A T 9: 109,323,751 (GRCm39) W75R probably benign Het
Fcgr4 A G 1: 170,856,838 (GRCm39) Y235C probably damaging Het
Gm10110 A C 14: 90,135,733 (GRCm39) noncoding transcript Het
Gm13030 A T 4: 138,598,708 (GRCm39) probably null Het
Hdac9 T C 12: 34,102,323 (GRCm39) M1058V probably damaging Het
Hsd3b6 A G 3: 98,713,540 (GRCm39) F253S probably damaging Het
Hspg2 T C 4: 137,289,266 (GRCm39) Y3794H probably damaging Het
Mark4 G A 7: 19,177,208 (GRCm39) T207M probably damaging Het
Mme A G 3: 63,249,382 (GRCm39) T304A probably benign Het
Neb A G 2: 52,148,275 (GRCm39) L2657P probably damaging Het
Nufip1 A C 14: 76,349,425 (GRCm39) K152N probably damaging Het
Pcdh1 A G 18: 38,331,860 (GRCm39) V381A probably benign Het
Pdss1 A G 2: 22,791,778 (GRCm39) T30A probably damaging Het
Plrg1 A G 3: 82,964,102 (GRCm39) T12A probably damaging Het
Ppig C T 2: 69,579,902 (GRCm39) H479Y unknown Het
Prokr2 A G 2: 132,215,898 (GRCm39) F188L probably damaging Het
Prss39 A G 1: 34,539,150 (GRCm39) N130S probably benign Het
Ptar1 G A 19: 23,671,686 (GRCm39) D30N possibly damaging Het
Rai14 G T 15: 10,575,022 (GRCm39) Y645* probably null Het
Rnasek T C 11: 70,129,252 (GRCm39) Y67C probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rnf213 T C 11: 119,354,192 (GRCm39) V4023A probably damaging Het
Sash3 C T X: 47,248,398 (GRCm39) L307F probably damaging Homo
Sctr T C 1: 119,984,182 (GRCm39) F357L probably damaging Het
Sec14l5 G A 16: 4,984,908 (GRCm39) V85I probably benign Het
Shld2 G A 14: 33,989,565 (GRCm39) T447M probably damaging Het
Sirpd T C 3: 15,385,671 (GRCm39) Y77C probably damaging Het
Spag8 T C 4: 43,653,186 (GRCm39) probably benign Het
Tbc1d2 T C 4: 46,620,736 (GRCm39) D358G possibly damaging Het
Tent2 G A 13: 93,322,821 (GRCm39) Q43* probably null Het
Trmt1l T A 1: 151,329,685 (GRCm39) S543T probably benign Het
Ube4b A G 4: 149,432,494 (GRCm39) F810S probably damaging Het
Vmn2r104 C T 17: 20,249,848 (GRCm39) V808I probably benign Het
Zfp3 T A 11: 70,662,266 (GRCm39) I75N probably benign Het
Zwint A G 10: 72,490,784 (GRCm39) probably benign Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96,517,216 (GRCm39) missense probably benign 0.00
IGL00468:Tenm4 APN 7 96,523,679 (GRCm39) missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96,454,345 (GRCm39) splice site probably benign
IGL00979:Tenm4 APN 7 96,378,598 (GRCm39) missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96,523,474 (GRCm39) missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96,378,592 (GRCm39) missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96,544,384 (GRCm39) missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96,523,510 (GRCm39) missense probably benign 0.00
IGL01579:Tenm4 APN 7 96,512,709 (GRCm39) missense probably benign 0.00
IGL01587:Tenm4 APN 7 96,512,709 (GRCm39) missense probably benign 0.00
IGL01625:Tenm4 APN 7 96,534,565 (GRCm39) missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96,202,931 (GRCm39) missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96,534,611 (GRCm39) missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96,545,271 (GRCm39) missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96,544,716 (GRCm39) missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96,544,419 (GRCm39) missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96,202,757 (GRCm39) missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96,544,869 (GRCm39) missense probably benign 0.40
IGL02207:Tenm4 APN 7 96,523,323 (GRCm39) missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96,473,029 (GRCm39) missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96,503,941 (GRCm39) missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96,353,344 (GRCm39) missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96,523,281 (GRCm39) missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96,423,383 (GRCm39) unclassified probably benign
IGL02656:Tenm4 APN 7 96,534,640 (GRCm39) missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96,545,426 (GRCm39) missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96,544,205 (GRCm39) nonsense probably null
IGL02863:Tenm4 APN 7 96,522,913 (GRCm39) missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96,492,175 (GRCm39) missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96,522,969 (GRCm39) missense probably damaging 1.00
principium UTSW 7 96,446,688 (GRCm39) missense probably damaging 0.98
toccata UTSW 7 96,552,196 (GRCm39) critical splice donor site probably null
P0026:Tenm4 UTSW 7 96,523,734 (GRCm39) missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96,542,133 (GRCm39) missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96,542,133 (GRCm39) missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96,545,259 (GRCm39) missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96,378,547 (GRCm39) splice site probably benign
R0277:Tenm4 UTSW 7 96,344,157 (GRCm39) missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96,344,157 (GRCm39) missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96,421,242 (GRCm39) nonsense probably null
R0381:Tenm4 UTSW 7 96,555,088 (GRCm39) missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96,522,973 (GRCm39) missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96,427,058 (GRCm39) missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96,544,830 (GRCm39) missense probably benign 0.35
R0624:Tenm4 UTSW 7 96,423,227 (GRCm39) missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96,545,482 (GRCm39) splice site probably benign
R1037:Tenm4 UTSW 7 96,446,688 (GRCm39) missense probably damaging 0.98
R1172:Tenm4 UTSW 7 96,497,251 (GRCm39) missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96,199,258 (GRCm39) missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96,492,255 (GRCm39) missense probably benign 0.42
R1462:Tenm4 UTSW 7 96,353,360 (GRCm39) missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96,353,360 (GRCm39) missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96,552,196 (GRCm39) critical splice donor site probably null
R1701:Tenm4 UTSW 7 96,552,096 (GRCm39) missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96,537,892 (GRCm39) missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96,522,987 (GRCm39) missense probably benign 0.17
R1812:Tenm4 UTSW 7 96,545,147 (GRCm39) missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96,385,015 (GRCm39) missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96,544,533 (GRCm39) missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96,385,015 (GRCm39) missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96,555,497 (GRCm39) missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96,552,054 (GRCm39) missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96,555,216 (GRCm39) missense probably benign 0.03
R2329:Tenm4 UTSW 7 96,545,069 (GRCm39) missense probably benign 0.00
R2893:Tenm4 UTSW 7 96,544,197 (GRCm39) missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96,542,332 (GRCm39) splice site probably null
R3409:Tenm4 UTSW 7 96,544,367 (GRCm39) missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96,501,737 (GRCm39) missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96,501,737 (GRCm39) missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96,202,723 (GRCm39) missense probably benign 0.00
R3441:Tenm4 UTSW 7 96,202,723 (GRCm39) missense probably benign 0.00
R3719:Tenm4 UTSW 7 96,512,770 (GRCm39) missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96,344,087 (GRCm39) missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96,344,087 (GRCm39) missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96,544,979 (GRCm39) missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4441:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4510:Tenm4 UTSW 7 96,544,070 (GRCm39) missense probably benign
R4511:Tenm4 UTSW 7 96,544,070 (GRCm39) missense probably benign
R4543:Tenm4 UTSW 7 96,545,022 (GRCm39) missense probably benign 0.01
R4645:Tenm4 UTSW 7 96,544,949 (GRCm39) missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96,544,556 (GRCm39) missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96,544,131 (GRCm39) missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96,446,691 (GRCm39) missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96,423,253 (GRCm39) missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96,555,452 (GRCm39) missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96,555,452 (GRCm39) missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96,555,025 (GRCm39) splice site probably null
R5036:Tenm4 UTSW 7 96,501,768 (GRCm39) missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96,343,997 (GRCm39) missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96,544,995 (GRCm39) missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96,492,164 (GRCm39) missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96,492,356 (GRCm39) missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96,542,293 (GRCm39) missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96,523,410 (GRCm39) missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96,486,538 (GRCm39) missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96,538,034 (GRCm39) missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96,543,887 (GRCm39) missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96,545,416 (GRCm39) nonsense probably null
R5590:Tenm4 UTSW 7 96,446,608 (GRCm39) missense possibly damaging 0.93
R5590:Tenm4 UTSW 7 96,446,607 (GRCm39) missense possibly damaging 0.73
R5597:Tenm4 UTSW 7 96,202,724 (GRCm39) missense probably benign 0.00
R5782:Tenm4 UTSW 7 96,542,246 (GRCm39) missense probably benign 0.00
R5861:Tenm4 UTSW 7 96,492,424 (GRCm39) intron probably benign
R5890:Tenm4 UTSW 7 96,552,067 (GRCm39) missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96,503,926 (GRCm39) missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96,495,102 (GRCm39) missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96,171,640 (GRCm39) intron probably benign
R6060:Tenm4 UTSW 7 96,522,918 (GRCm39) missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96,486,496 (GRCm39) missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96,523,701 (GRCm39) missense probably benign 0.33
R6522:Tenm4 UTSW 7 96,492,251 (GRCm39) missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6746:Tenm4 UTSW 7 96,542,067 (GRCm39) missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96,494,919 (GRCm39) missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96,461,166 (GRCm39) missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96,544,478 (GRCm39) missense probably damaging 1.00
R6807:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6809:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6810:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6811:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6853:Tenm4 UTSW 7 96,486,502 (GRCm39) missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96,446,599 (GRCm39) missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96,544,757 (GRCm39) missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R6939:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7011:Tenm4 UTSW 7 96,545,342 (GRCm39) nonsense probably null
R7033:Tenm4 UTSW 7 96,544,430 (GRCm39) nonsense probably null
R7040:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7083:Tenm4 UTSW 7 96,544,556 (GRCm39) missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7239:Tenm4 UTSW 7 96,385,020 (GRCm39) missense possibly damaging 0.47
R7239:Tenm4 UTSW 7 96,202,703 (GRCm39) missense probably benign 0.01
R7337:Tenm4 UTSW 7 96,523,333 (GRCm39) missense probably benign 0.44
R7400:Tenm4 UTSW 7 96,344,010 (GRCm39) missense probably damaging 0.97
R7407:Tenm4 UTSW 7 96,423,194 (GRCm39) missense possibly damaging 0.89
R7449:Tenm4 UTSW 7 96,523,420 (GRCm39) missense possibly damaging 0.65
R7473:Tenm4 UTSW 7 96,423,353 (GRCm39) missense probably damaging 1.00
R7477:Tenm4 UTSW 7 96,495,015 (GRCm39) missense probably damaging 0.99
R7489:Tenm4 UTSW 7 96,486,521 (GRCm39) missense possibly damaging 0.90
R7498:Tenm4 UTSW 7 96,497,224 (GRCm39) missense probably damaging 1.00
R7562:Tenm4 UTSW 7 96,538,021 (GRCm39) missense probably damaging 1.00
R7615:Tenm4 UTSW 7 96,495,133 (GRCm39) missense probably damaging 1.00
R7624:Tenm4 UTSW 7 96,545,192 (GRCm39) missense possibly damaging 0.95
R7626:Tenm4 UTSW 7 96,542,221 (GRCm39) missense probably damaging 1.00
R7690:Tenm4 UTSW 7 96,512,740 (GRCm39) missense probably benign 0.00
R7692:Tenm4 UTSW 7 96,544,610 (GRCm39) missense probably damaging 1.00
R7748:Tenm4 UTSW 7 96,543,909 (GRCm39) missense probably damaging 1.00
R7763:Tenm4 UTSW 7 96,544,899 (GRCm39) missense probably benign 0.38
R7792:Tenm4 UTSW 7 96,423,221 (GRCm39) missense possibly damaging 0.54
R7855:Tenm4 UTSW 7 96,523,081 (GRCm39) missense probably damaging 1.00
R7868:Tenm4 UTSW 7 96,555,587 (GRCm39) missense possibly damaging 0.79
R7878:Tenm4 UTSW 7 96,501,564 (GRCm39) missense probably damaging 1.00
R7997:Tenm4 UTSW 7 96,523,512 (GRCm39) missense probably benign 0.44
R8017:Tenm4 UTSW 7 96,353,248 (GRCm39) missense probably damaging 1.00
R8019:Tenm4 UTSW 7 96,353,248 (GRCm39) missense probably damaging 1.00
R8054:Tenm4 UTSW 7 96,378,553 (GRCm39) splice site probably benign
R8061:Tenm4 UTSW 7 96,501,663 (GRCm39) missense probably damaging 1.00
R8108:Tenm4 UTSW 7 96,503,935 (GRCm39) missense probably benign 0.39
R8140:Tenm4 UTSW 7 96,544,383 (GRCm39) missense probably damaging 1.00
R8214:Tenm4 UTSW 7 96,544,614 (GRCm39) missense probably damaging 1.00
R8258:Tenm4 UTSW 7 96,517,198 (GRCm39) missense probably damaging 1.00
R8259:Tenm4 UTSW 7 96,517,198 (GRCm39) missense probably damaging 1.00
R8364:Tenm4 UTSW 7 96,421,313 (GRCm39) critical splice donor site probably null
R8542:Tenm4 UTSW 7 96,461,139 (GRCm39) missense probably damaging 0.99
R8669:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8670:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8683:Tenm4 UTSW 7 96,552,064 (GRCm39) missense probably damaging 0.99
R8691:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8692:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8714:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8716:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8735:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8736:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8737:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8738:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8738:Tenm4 UTSW 7 96,523,047 (GRCm39) missense probably damaging 1.00
R8739:Tenm4 UTSW 7 96,555,148 (GRCm39) missense probably benign
R8776:Tenm4 UTSW 7 96,544,239 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Tenm4 UTSW 7 96,544,239 (GRCm39) missense probably damaging 1.00
R8777:Tenm4 UTSW 7 96,545,244 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Tenm4 UTSW 7 96,545,244 (GRCm39) missense probably damaging 1.00
R8817:Tenm4 UTSW 7 96,523,335 (GRCm39) missense probably benign 0.01
R8851:Tenm4 UTSW 7 96,501,710 (GRCm39) missense probably damaging 1.00
R8913:Tenm4 UTSW 7 96,351,952 (GRCm39) splice site probably benign
R8977:Tenm4 UTSW 7 96,461,177 (GRCm39) missense probably damaging 1.00
R9100:Tenm4 UTSW 7 96,495,061 (GRCm39) missense probably damaging 1.00
R9136:Tenm4 UTSW 7 96,473,125 (GRCm39) missense possibly damaging 0.69
R9163:Tenm4 UTSW 7 96,473,080 (GRCm39) missense probably damaging 1.00
R9188:Tenm4 UTSW 7 96,421,234 (GRCm39) missense probably damaging 1.00
R9195:Tenm4 UTSW 7 96,542,126 (GRCm39) missense probably damaging 1.00
R9217:Tenm4 UTSW 7 96,534,646 (GRCm39) missense probably damaging 1.00
R9344:Tenm4 UTSW 7 96,545,352 (GRCm39) missense probably damaging 1.00
R9414:Tenm4 UTSW 7 96,545,367 (GRCm39) missense probably benign
R9466:Tenm4 UTSW 7 96,199,252 (GRCm39) missense possibly damaging 0.79
R9559:Tenm4 UTSW 7 96,473,056 (GRCm39) missense probably benign
R9626:Tenm4 UTSW 7 96,545,345 (GRCm39) missense probably damaging 1.00
R9673:Tenm4 UTSW 7 96,517,196 (GRCm39) missense probably damaging 1.00
R9676:Tenm4 UTSW 7 96,544,638 (GRCm39) missense probably damaging 1.00
R9678:Tenm4 UTSW 7 96,386,619 (GRCm39) missense possibly damaging 0.94
R9775:Tenm4 UTSW 7 96,555,761 (GRCm39) missense possibly damaging 0.92
R9790:Tenm4 UTSW 7 96,538,046 (GRCm39) missense probably damaging 1.00
R9791:Tenm4 UTSW 7 96,538,046 (GRCm39) missense probably damaging 1.00
R9803:Tenm4 UTSW 7 96,202,685 (GRCm39) missense probably damaging 1.00
X0021:Tenm4 UTSW 7 96,523,116 (GRCm39) nonsense probably null
X0026:Tenm4 UTSW 7 96,517,294 (GRCm39) missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96,544,001 (GRCm39) missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96,497,237 (GRCm39) missense probably damaging 1.00
Z1176:Tenm4 UTSW 7 96,555,121 (GRCm39) missense probably benign 0.00
Z1177:Tenm4 UTSW 7 96,512,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCCAGGCTTTTGGTACTG -3'
(R):5'- CTGTCCCCGAATAACGCTAC -3'

Sequencing Primer
(F):5'- CAGGCTTTTGGTACTGTCTCTTCAG -3'
(R):5'- GAGCATTTACTAGGTGTCAGCCAC -3'
Posted On 2018-04-27