Incidental Mutation 'R6333:Chrnb3'
ID513238
Institutional Source Beutler Lab
Gene Symbol Chrnb3
Ensembl Gene ENSMUSG00000031492
Gene Namecholinergic receptor, nicotinic, beta polypeptide 3
SynonymsAcrb3, 5730417K16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6333 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location27368711-27399730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27393327 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 84 (N84D)
Ref Sequence ENSEMBL: ENSMUSP00000078428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060943] [ENSMUST00000079463] [ENSMUST00000211104]
Predicted Effect probably benign
Transcript: ENSMUST00000060943
AA Change: N99D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052297
Gene: ENSMUSG00000031492
AA Change: N99D

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 239 2.3e-75 PFAM
Pfam:Neur_chan_memb 246 452 1.9e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079463
AA Change: N84D

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078428
Gene: ENSMUSG00000031492
AA Change: N84D

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 35 224 1.3e-57 PFAM
Pfam:Neur_chan_memb 231 374 4.3e-48 PFAM
Pfam:Neur_chan_memb 349 437 9.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211104
AA Change: N99D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 97.9%
  • 20x: 93.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are (hetero)pentamers composed of homologous subunits. The subunits that make up the muscle and neuronal forms of nAChRs are encoded by separate genes and have different primary structure. There are several subtypes of neuronal nAChRs that vary based on which homologous subunits are arranged around the central channel. They are classified as alpha-subunits if, like muscle alpha-1 (MIM 100690), they have a pair of adjacent cysteines as part of the presumed acetylcholine binding site. Subunits lacking these cysteine residues are classified as beta-subunits (Groot Kormelink and Luyten, 1997 [PubMed 9009220]). Elliott et al. (1996) [PubMed 8906617] stated that the proposed structure for each subunit is a conserved N-terminal extracellular domain followed by 3 conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region.[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display hyperactivity and reflex abnormalities but were otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik T C 9: 15,292,076 K111R probably benign Het
Abhd18 A G 3: 40,933,783 Y354C probably benign Het
Acap1 T C 11: 69,883,601 I424V possibly damaging Het
AI182371 A T 2: 35,085,269 I306K probably damaging Het
Asb4 G A 6: 5,423,597 R248H probably damaging Het
Brd7 T C 8: 88,345,191 T349A probably damaging Het
Bub1b T C 2: 118,598,463 probably null Het
Cep85l G A 10: 53,349,101 Q131* probably null Het
Chmp2b T A 16: 65,540,250 M178L possibly damaging Het
Clec4b2 A T 6: 123,200,678 probably null Het
Defa34 T C 8: 21,665,846 V17A probably benign Het
Dnah3 A T 7: 120,054,633 L947Q probably damaging Het
Ell A G 8: 70,591,538 Y578C probably damaging Het
Esp36 T A 17: 38,417,244 M49L probably benign Het
Fam35a G A 14: 34,267,608 T447M probably damaging Het
Fbxw19 A T 9: 109,494,683 W75R probably benign Het
Fcgr4 A G 1: 171,029,269 Y235C probably damaging Het
Gm10110 A C 14: 89,898,297 noncoding transcript Het
Gm13030 A T 4: 138,871,397 probably null Het
Gm9733 T C 3: 15,320,611 Y77C probably damaging Het
Hdac9 T C 12: 34,052,324 M1058V probably damaging Het
Hsd3b6 A G 3: 98,806,224 F253S probably damaging Het
Hspg2 T C 4: 137,561,955 Y3794H probably damaging Het
Mark4 G A 7: 19,443,283 T207M probably damaging Het
Mme A G 3: 63,341,961 T304A probably benign Het
Neb A G 2: 52,258,263 L2657P probably damaging Het
Nufip1 A C 14: 76,111,985 K152N probably damaging Het
Papd4 G A 13: 93,186,313 Q43* probably null Het
Pcdh1 A G 18: 38,198,807 V381A probably benign Het
Pdss1 A G 2: 22,901,766 T30A probably damaging Het
Plrg1 A G 3: 83,056,795 T12A probably damaging Het
Ppig C T 2: 69,749,558 H479Y unknown Het
Prokr2 A G 2: 132,373,978 F188L probably damaging Het
Prss39 A G 1: 34,500,069 N130S probably benign Het
Ptar1 G A 19: 23,694,322 D30N possibly damaging Het
Rai14 G T 15: 10,574,936 Y645* probably null Het
Rnasek T C 11: 70,238,426 Y67C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,463,366 V4023A probably damaging Het
Sash3 C T X: 48,159,521 L307F probably damaging Homo
Sctr T C 1: 120,056,452 F357L probably damaging Het
Sec14l5 G A 16: 5,167,044 V85I probably benign Het
Spag8 T C 4: 43,653,186 probably benign Het
Tbc1d2 T C 4: 46,620,736 D358G possibly damaging Het
Tcte3 G A 17: 15,041,455 probably benign Het
Tenm4 A G 7: 96,774,124 T672A probably damaging Het
Trmt1l T A 1: 151,453,934 S543T probably benign Het
Ube4b A G 4: 149,348,037 F810S probably damaging Het
Vmn2r104 C T 17: 20,029,586 V808I probably benign Het
Zfp3 T A 11: 70,771,440 I75N probably benign Het
Zwint A G 10: 72,654,952 probably benign Het
Other mutations in Chrnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Chrnb3 APN 8 27385101 missense probably benign 0.13
IGL01655:Chrnb3 APN 8 27394174 missense probably damaging 1.00
IGL02124:Chrnb3 APN 8 27396804 unclassified probably benign
IGL02403:Chrnb3 APN 8 27393808 missense probably damaging 1.00
IGL02474:Chrnb3 APN 8 27393369 missense probably damaging 1.00
IGL02903:Chrnb3 APN 8 27386806 missense probably damaging 0.96
R0178:Chrnb3 UTSW 8 27393364 missense probably damaging 1.00
R0736:Chrnb3 UTSW 8 27385050 missense probably benign 0.00
R1695:Chrnb3 UTSW 8 27393700 missense probably damaging 1.00
R2051:Chrnb3 UTSW 8 27386811 missense probably damaging 1.00
R2091:Chrnb3 UTSW 8 27394234 missense probably damaging 1.00
R2313:Chrnb3 UTSW 8 27393781 missense probably damaging 1.00
R3020:Chrnb3 UTSW 8 27396784 missense probably benign
R3981:Chrnb3 UTSW 8 27394006 missense probably damaging 1.00
R4236:Chrnb3 UTSW 8 27393993 missense probably damaging 1.00
R4276:Chrnb3 UTSW 8 27393751 missense probably damaging 1.00
R4422:Chrnb3 UTSW 8 27396733 missense possibly damaging 0.84
R4515:Chrnb3 UTSW 8 27385090 missense probably damaging 1.00
R4688:Chrnb3 UTSW 8 27394119 missense probably damaging 1.00
R4931:Chrnb3 UTSW 8 27394230 missense probably damaging 0.99
R5164:Chrnb3 UTSW 8 27394132 missense probably damaging 1.00
R6454:Chrnb3 UTSW 8 27393375 missense probably damaging 1.00
R7070:Chrnb3 UTSW 8 27393961 missense probably damaging 1.00
R8060:Chrnb3 UTSW 8 27394560 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCAGGGCTGAATCCTAGAG -3'
(R):5'- ACTCACTGTTTGGAGGCAATCTAC -3'

Sequencing Primer
(F):5'- GAGGATACCACGTTTTAACCTGG -3'
(R):5'- CAAGTCATGTTTTACAGAGAAACCAC -3'
Posted On2018-04-27