Incidental Mutation 'R6333:Gm10110'
ID513254
Institutional Source Beutler Lab
Gene Symbol Gm10110
Ensembl Gene ENSMUSG00000062093
Gene Namepredicted gene 10110
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R6333 (G1)
Quality Score187.009
Status Validated
Chromosome14
Chromosomal Location89896223-89898466 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to C at 89898297 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000081204]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081204
SMART Domains Protein: ENSMUSP00000079967
Gene: ENSMUSG00000062093

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 1.92e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228705
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 97.9%
  • 20x: 93.2%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik T C 9: 15,292,076 K111R probably benign Het
Abhd18 A G 3: 40,933,783 Y354C probably benign Het
Acap1 T C 11: 69,883,601 I424V possibly damaging Het
AI182371 A T 2: 35,085,269 I306K probably damaging Het
Asb4 G A 6: 5,423,597 R248H probably damaging Het
Brd7 T C 8: 88,345,191 T349A probably damaging Het
Bub1b T C 2: 118,598,463 probably null Het
Cep85l G A 10: 53,349,101 Q131* probably null Het
Chmp2b T A 16: 65,540,250 M178L possibly damaging Het
Chrnb3 A G 8: 27,393,327 N84D probably damaging Het
Clec4b2 A T 6: 123,200,678 probably null Het
Defa34 T C 8: 21,665,846 V17A probably benign Het
Dnah3 A T 7: 120,054,633 L947Q probably damaging Het
Ell A G 8: 70,591,538 Y578C probably damaging Het
Esp36 T A 17: 38,417,244 M49L probably benign Het
Fam35a G A 14: 34,267,608 T447M probably damaging Het
Fbxw19 A T 9: 109,494,683 W75R probably benign Het
Fcgr4 A G 1: 171,029,269 Y235C probably damaging Het
Gm13030 A T 4: 138,871,397 probably null Het
Gm9733 T C 3: 15,320,611 Y77C probably damaging Het
Hdac9 T C 12: 34,052,324 M1058V probably damaging Het
Hsd3b6 A G 3: 98,806,224 F253S probably damaging Het
Hspg2 T C 4: 137,561,955 Y3794H probably damaging Het
Mark4 G A 7: 19,443,283 T207M probably damaging Het
Mme A G 3: 63,341,961 T304A probably benign Het
Neb A G 2: 52,258,263 L2657P probably damaging Het
Nufip1 A C 14: 76,111,985 K152N probably damaging Het
Papd4 G A 13: 93,186,313 Q43* probably null Het
Pcdh1 A G 18: 38,198,807 V381A probably benign Het
Pdss1 A G 2: 22,901,766 T30A probably damaging Het
Plrg1 A G 3: 83,056,795 T12A probably damaging Het
Ppig C T 2: 69,749,558 H479Y unknown Het
Prokr2 A G 2: 132,373,978 F188L probably damaging Het
Prss39 A G 1: 34,500,069 N130S probably benign Het
Ptar1 G A 19: 23,694,322 D30N possibly damaging Het
Rai14 G T 15: 10,574,936 Y645* probably null Het
Rnasek T C 11: 70,238,426 Y67C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf213 T C 11: 119,463,366 V4023A probably damaging Het
Sash3 C T X: 48,159,521 L307F probably damaging Homo
Sctr T C 1: 120,056,452 F357L probably damaging Het
Sec14l5 G A 16: 5,167,044 V85I probably benign Het
Spag8 T C 4: 43,653,186 probably benign Het
Tbc1d2 T C 4: 46,620,736 D358G possibly damaging Het
Tcte3 G A 17: 15,041,455 probably benign Het
Tenm4 A G 7: 96,774,124 T672A probably damaging Het
Trmt1l T A 1: 151,453,934 S543T probably benign Het
Ube4b A G 4: 149,348,037 F810S probably damaging Het
Vmn2r104 C T 17: 20,029,586 V808I probably benign Het
Zfp3 T A 11: 70,771,440 I75N probably benign Het
Zwint A G 10: 72,654,952 probably benign Het
Other mutations in Gm10110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Gm10110 APN 14 89898241 exon noncoding transcript
IGL02308:Gm10110 APN 14 89897595 exon noncoding transcript
IGL02977:Gm10110 APN 14 89897332 exon noncoding transcript
IGL03230:Gm10110 APN 14 89898297 exon noncoding transcript
R0966:Gm10110 UTSW 14 89898119 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1640:Gm10110 UTSW 14 89898243 exon noncoding transcript
R1762:Gm10110 UTSW 14 89897389 exon noncoding transcript
R1839:Gm10110 UTSW 14 89897836 exon noncoding transcript
R2679:Gm10110 UTSW 14 89897416 exon noncoding transcript
R3907:Gm10110 UTSW 14 89898147 exon noncoding transcript
R4512:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4513:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4590:Gm10110 UTSW 14 89897546 exon noncoding transcript
R4877:Gm10110 UTSW 14 89897349 exon noncoding transcript
R5771:Gm10110 UTSW 14 89897239 exon noncoding transcript
R6341:Gm10110 UTSW 14 89896708 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGTCATACAGTGCCTTGTTGTC -3'
(R):5'- CTTGTTAGAAGTCCTCCTGGCG -3'

Sequencing Primer
(F):5'- CATACAGTGCCTTGTTGTCTATGG -3'
(R):5'- GGGGGTGGGGAGATGAATGC -3'
Posted On2018-04-27