Incidental Mutation 'R6352:Fam126b'
ID513264
Institutional Source Beutler Lab
Gene Symbol Fam126b
Ensembl Gene ENSMUSG00000038174
Gene Namefamily with sequence similarity 126, member B
SynonymsD1Ertd53e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location58522806-58586323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58557312 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 38 (V38A)
Ref Sequence ENSEMBL: ENSMUSP00000123728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038372] [ENSMUST00000097724] [ENSMUST00000161000] [ENSMUST00000161600] [ENSMUST00000187717]
Predicted Effect probably damaging
Transcript: ENSMUST00000038372
AA Change: V38A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038718
Gene: ENSMUSG00000038174
AA Change: V38A

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097724
AA Change: V38A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095331
Gene: ENSMUSG00000038174
AA Change: V38A

DomainStartEndE-ValueType
Pfam:Hyccin 22 330 3.3e-126 PFAM
low complexity region 374 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160546
Predicted Effect probably damaging
Transcript: ENSMUST00000161000
AA Change: V38A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125653
Gene: ENSMUSG00000038174
AA Change: V38A

DomainStartEndE-ValueType
Pfam:Hyccin 20 99 3e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161600
AA Change: V38A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123728
Gene: ENSMUSG00000038174
AA Change: V38A

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187717
AA Change: V38A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.4070 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Fam126b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Fam126b APN 1 58540253 splice site probably benign
IGL00468:Fam126b APN 1 58530232 missense probably benign 0.25
IGL00701:Fam126b APN 1 58535482 missense possibly damaging 0.59
IGL00795:Fam126b APN 1 58552179 missense probably damaging 1.00
IGL02023:Fam126b APN 1 58530115 missense possibly damaging 0.53
IGL02501:Fam126b APN 1 58540191 missense probably damaging 1.00
IGL02657:Fam126b APN 1 58535402 missense probably damaging 1.00
IGL02970:Fam126b APN 1 58539617 missense probably damaging 1.00
IGL03221:Fam126b APN 1 58540186 missense probably benign 0.00
IGL03240:Fam126b APN 1 58529917 missense probably damaging 1.00
PIT4812001:Fam126b UTSW 1 58548703 missense possibly damaging 0.78
R0455:Fam126b UTSW 1 58534479 splice site probably benign
R1479:Fam126b UTSW 1 58552268 nonsense probably null
R1529:Fam126b UTSW 1 58539607 missense probably benign 0.00
R4275:Fam126b UTSW 1 58529933 missense probably benign
R5164:Fam126b UTSW 1 58535438 missense probably benign 0.13
R6332:Fam126b UTSW 1 58529875 missense probably damaging 0.99
R6549:Fam126b UTSW 1 58539600 missense probably benign 0.03
R7034:Fam126b UTSW 1 58535537 missense probably benign 0.17
R7036:Fam126b UTSW 1 58535537 missense probably benign 0.17
R7100:Fam126b UTSW 1 58534494 missense possibly damaging 0.94
R7237:Fam126b UTSW 1 58529948 nonsense probably null
R7378:Fam126b UTSW 1 58530034 missense probably benign 0.00
R7403:Fam126b UTSW 1 58548702 missense possibly damaging 0.59
R8015:Fam126b UTSW 1 58535482 missense possibly damaging 0.59
R8249:Fam126b UTSW 1 58534637 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCCAAAGCAACTATCAGGATG -3'
(R):5'- GGGTAGCTTTAAGATGACATGTTC -3'

Sequencing Primer
(F):5'- CCAAAGCAACTATCAGGATGAAAAAG -3'
(R):5'- CATGGATAAGTAGCTAGAAAACTTGC -3'
Posted On2018-04-27