Incidental Mutation 'R6352:Mllt10'
ID513266
Institutional Source Beutler Lab
Gene Symbol Mllt10
Ensembl Gene ENSMUSG00000026743
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 10
SynonymsAf10, D630001B22Rik, B130021D15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location18055237-18212388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 18123793 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 117 (K117T)
Ref Sequence ENSEMBL: ENSMUSP00000110319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028076] [ENSMUST00000114669] [ENSMUST00000114671] [ENSMUST00000114680]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028076
AA Change: K195T

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028076
Gene: ENSMUSG00000026743
AA Change: K195T

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114669
SMART Domains Protein: ENSMUSP00000110317
Gene: ENSMUSG00000026743

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
low complexity region 66 84 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
coiled coil region 198 239 N/A INTRINSIC
low complexity region 293 336 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 454 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114671
AA Change: K117T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110319
Gene: ENSMUSG00000026743
AA Change: K117T

DomainStartEndE-ValueType
PHD 58 117 2.92e-6 SMART
low complexity region 139 170 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 412 437 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
low complexity region 531 549 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
coiled coil region 663 704 N/A INTRINSIC
low complexity region 758 801 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
low complexity region 888 908 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114680
AA Change: K195T

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110328
Gene: ENSMUSG00000026743
AA Change: K195T

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154041
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor and has been identified as a partner gene involved in several chromosomal rearrangements resulting in various leukemias. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Mllt10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Mllt10 APN 2 18122317 missense probably damaging 1.00
IGL02366:Mllt10 APN 2 18065087 missense probably damaging 0.99
IGL02990:Mllt10 APN 2 18123711 splice site probably benign
IGL03034:Mllt10 APN 2 18065036 start codon destroyed probably null 0.55
R0348:Mllt10 UTSW 2 18162613 missense probably damaging 1.00
R0487:Mllt10 UTSW 2 18207137 missense probably damaging 0.98
R0492:Mllt10 UTSW 2 18146887 splice site probably benign
R0518:Mllt10 UTSW 2 18071206 critical splice donor site probably null
R0720:Mllt10 UTSW 2 18196595 missense probably benign
R0733:Mllt10 UTSW 2 18203766 intron probably benign
R1532:Mllt10 UTSW 2 18092835 critical splice donor site probably null
R1665:Mllt10 UTSW 2 18208790 missense possibly damaging 0.93
R1768:Mllt10 UTSW 2 18162846 missense probably damaging 1.00
R2098:Mllt10 UTSW 2 18162653 missense possibly damaging 0.50
R2114:Mllt10 UTSW 2 18162569 missense probably benign
R2116:Mllt10 UTSW 2 18162569 missense probably benign
R2117:Mllt10 UTSW 2 18162569 missense probably benign
R2179:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R2192:Mllt10 UTSW 2 18207060 missense probably benign 0.11
R2510:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R2511:Mllt10 UTSW 2 18065124 missense possibly damaging 0.94
R4669:Mllt10 UTSW 2 18203633 missense probably damaging 1.00
R5004:Mllt10 UTSW 2 18170268 missense probably damaging 1.00
R5072:Mllt10 UTSW 2 18109874 missense possibly damaging 0.72
R5187:Mllt10 UTSW 2 18208774 nonsense probably null
R5561:Mllt10 UTSW 2 18109845 missense probably damaging 0.98
R6141:Mllt10 UTSW 2 18210793 missense probably damaging 1.00
R6844:Mllt10 UTSW 2 18159483 missense probably benign 0.02
R7060:Mllt10 UTSW 2 18159560 missense possibly damaging 0.64
R7464:Mllt10 UTSW 2 18170279 missense probably benign
R7691:Mllt10 UTSW 2 18203611 missense possibly damaging 0.94
R7691:Mllt10 UTSW 2 18203612 missense probably null 0.94
R8079:Mllt10 UTSW 2 18123756 missense probably damaging 0.99
R8084:Mllt10 UTSW 2 18109826 missense probably damaging 0.99
Z1177:Mllt10 UTSW 2 18171076 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCTGTCTTTCAGGTGCC -3'
(R):5'- GTCAATAAGGAACAGGCTAAATGTC -3'

Sequencing Primer
(F):5'- CTGTCTTTCAGGTGCCAAAAAGG -3'
(R):5'- CAGGCTAAATGTCTGCACTGG -3'
Posted On2018-04-27