Incidental Mutation 'R6352:Kcnj3'
ID513267
Institutional Source Beutler Lab
Gene Symbol Kcnj3
Ensembl Gene ENSMUSG00000026824
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 3
SynonymsGIRK1, Kcnf3, Kir3.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location55435970-55598145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55437549 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 117 (V117I)
Ref Sequence ENSEMBL: ENSMUSP00000108251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067101] [ENSMUST00000112632] [ENSMUST00000112633]
Predicted Effect probably benign
Transcript: ENSMUST00000067101
AA Change: V117I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000063329
Gene: ENSMUSG00000026824
AA Change: V117I

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 385 3.6e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112632
AA Change: V117I

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108251
Gene: ENSMUSG00000026824
AA Change: V117I

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 235 4e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112633
AA Change: V117I

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108252
Gene: ENSMUSG00000026824
AA Change: V117I

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 369 1.1e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180810
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and plays an important role in regulating heartbeat. It associates with three other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex that also couples to neurotransmitter receptors in the brain and whereby channel activation can inhibit action potential firing by hyperpolarizing the plasma membrane. These multimeric G-protein-gated inwardly-rectifying potassium (GIRK) channels may play a role in the pathophysiology of epilepsy, addiction, Down's syndrome, ataxia, and Parkinson's disease. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation display slightly increased resting heart rates, and blunted responses to both indirect vagal activation and direct adenosine A1 receptor activation (intended to activate the muscarinic-gated atrial potassium channel). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Kcnj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Kcnj3 APN 2 55595272 missense possibly damaging 0.88
IGL01889:Kcnj3 APN 2 55437204 missense possibly damaging 0.69
IGL01988:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL01989:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL02004:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL02035:Kcnj3 APN 2 55437578 missense probably damaging 1.00
R0268:Kcnj3 UTSW 2 55594959 nonsense probably null
R0565:Kcnj3 UTSW 2 55595264 missense probably benign 0.03
R0853:Kcnj3 UTSW 2 55437223 missense possibly damaging 0.69
R1318:Kcnj3 UTSW 2 55437738 missense possibly damaging 0.88
R1592:Kcnj3 UTSW 2 55437886 missense probably damaging 1.00
R1756:Kcnj3 UTSW 2 55437220 missense probably damaging 1.00
R1899:Kcnj3 UTSW 2 55437244 missense probably damaging 1.00
R1966:Kcnj3 UTSW 2 55437331 missense probably damaging 0.99
R2891:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R2892:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R2893:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R3901:Kcnj3 UTSW 2 55437348 missense possibly damaging 0.46
R4470:Kcnj3 UTSW 2 55437865 missense probably damaging 1.00
R4603:Kcnj3 UTSW 2 55446979 nonsense probably null
R4694:Kcnj3 UTSW 2 55594906 missense probably benign 0.00
R4945:Kcnj3 UTSW 2 55437578 missense probably damaging 1.00
R5144:Kcnj3 UTSW 2 55447047 splice site probably null
R5332:Kcnj3 UTSW 2 55437547 missense probably damaging 1.00
R5959:Kcnj3 UTSW 2 55437318 missense probably benign 0.10
R7042:Kcnj3 UTSW 2 55594865 missense possibly damaging 0.87
R7475:Kcnj3 UTSW 2 55437326 missense probably benign 0.09
R7626:Kcnj3 UTSW 2 55594821 nonsense probably null
R7771:Kcnj3 UTSW 2 55446937 missense probably damaging 1.00
R8225:Kcnj3 UTSW 2 55437714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGCAGCATGGTAACCTG -3'
(R):5'- GCTGGGACATCTTGATGAACATG -3'

Sequencing Primer
(F):5'- CAGCATGGTAACCTGGGCAG -3'
(R):5'- TCTTGATGAACATGCAGCCG -3'
Posted On2018-04-27