Incidental Mutation 'R6352:Fmo5'
ID513269
Institutional Source Beutler Lab
Gene Symbol Fmo5
Ensembl Gene ENSMUSG00000028088
Gene Nameflavin containing monooxygenase 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location97628804-97655282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97645675 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 313 (V313A)
Ref Sequence ENSEMBL: ENSMUSP00000102665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029729] [ENSMUST00000107049] [ENSMUST00000107050]
Predicted Effect probably benign
Transcript: ENSMUST00000029729
AA Change: V313A

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029729
Gene: ENSMUSG00000028088
AA Change: V313A

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 5 224 3.4e-8 PFAM
Pfam:Pyr_redox_3 7 221 2.2e-21 PFAM
Pfam:NAD_binding_8 8 69 1.7e-6 PFAM
Pfam:K_oxygenase 81 223 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107049
AA Change: V313A

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102664
Gene: ENSMUSG00000028088
AA Change: V313A

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 5 224 3.4e-8 PFAM
Pfam:Pyr_redox_3 7 221 2.2e-21 PFAM
Pfam:NAD_binding_8 8 69 1.7e-6 PFAM
Pfam:K_oxygenase 81 223 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107050
AA Change: V313A

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102665
Gene: ENSMUSG00000028088
AA Change: V313A

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 4 228 8.5e-11 PFAM
Pfam:Pyr_redox_3 7 221 4.7e-11 PFAM
Pfam:NAD_binding_8 8 70 3.5e-7 PFAM
Pfam:K_oxygenase 80 222 2.9e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show an age-related lean phenotype despite increased food intake, lower plasma levels of glucose and cholesterol, decreased fat storage in WAT, altered fatty acid oxidation, increased energy expenditure and respiratory quotient but normal physical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Fmo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Fmo5 APN 3 97651568 missense probably benign 0.19
IGL01926:Fmo5 APN 3 97637481 missense probably damaging 1.00
IGL03062:Fmo5 APN 3 97635593 missense probably damaging 1.00
IGL03215:Fmo5 APN 3 97641806 missense probably benign
IGL03323:Fmo5 APN 3 97639007 splice site probably null
PIT4445001:Fmo5 UTSW 3 97651528 missense probably benign 0.30
R0133:Fmo5 UTSW 3 97645636 missense probably damaging 0.99
R0207:Fmo5 UTSW 3 97645681 missense probably damaging 1.00
R0570:Fmo5 UTSW 3 97629140 missense probably damaging 1.00
R2014:Fmo5 UTSW 3 97635682 missense possibly damaging 0.56
R2093:Fmo5 UTSW 3 97645878 missense probably benign 0.41
R3087:Fmo5 UTSW 3 97641695 missense probably damaging 1.00
R3694:Fmo5 UTSW 3 97645914 missense probably damaging 1.00
R3764:Fmo5 UTSW 3 97645717 missense probably damaging 1.00
R4864:Fmo5 UTSW 3 97645879 missense probably damaging 1.00
R4987:Fmo5 UTSW 3 97635578 missense probably benign 0.23
R5152:Fmo5 UTSW 3 97641762 missense probably benign 0.00
R5304:Fmo5 UTSW 3 97651622 missense probably damaging 1.00
R5306:Fmo5 UTSW 3 97641760 missense probably benign 0.00
R5563:Fmo5 UTSW 3 97638891 missense probably damaging 1.00
R5888:Fmo5 UTSW 3 97641725 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCGATGCTTACATGCTGATTC -3'
(R):5'- GCTCTGAAATGGGCATAATGG -3'

Sequencing Primer
(F):5'- GATGCTTACATGCTGATTCCTTTC -3'
(R):5'- CTGAAATGGGCATAATGGCTCCC -3'
Posted On2018-04-27