Incidental Mutation 'R6352:Sdr16c5'
ID513271
Institutional Source Beutler Lab
Gene Symbol Sdr16c5
Ensembl Gene ENSMUSG00000028236
Gene Nameshort chain dehydrogenase/reductase family 16C, member 5
SynonymsRdhe2, Scdr9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location3995936-4019663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4016421 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000046298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040925]
Predicted Effect probably benign
Transcript: ENSMUST00000040925
AA Change: S2P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046298
Gene: ENSMUSG00000028236
AA Change: S2P

DomainStartEndE-ValueType
Pfam:KR 41 233 1.8e-17 PFAM
Pfam:adh_short 41 238 1.7e-48 PFAM
Pfam:adh_short_C2 47 228 1.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126274
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain alcohol dehydrogenase/reductase superfamily of proteins and is involved in the oxidation of retinol to retinaldehyde. The encoded protein is associated with the endoplasmic reticulum and is predicted to contain three transmembrane helices, suggesting that it is an integral membrane protein. It recognizes all-trans-retinol and all-trans-retinaldehyde as substrates and exhibits a strong preference for NAD(+)/NADH as cofactors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Sdr16c5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Sdr16c5 APN 4 4012320 splice site probably benign
IGL02230:Sdr16c5 APN 4 4016354 missense probably damaging 0.99
IGL03090:Sdr16c5 APN 4 4006575 splice site probably benign
PIT4802001:Sdr16c5 UTSW 4 4012423 missense probably damaging 1.00
R0377:Sdr16c5 UTSW 4 4005546 missense probably benign 0.03
R0610:Sdr16c5 UTSW 4 4016116 missense possibly damaging 0.81
R2012:Sdr16c5 UTSW 4 3996244 missense probably benign
R3735:Sdr16c5 UTSW 4 4005614 missense probably benign
R3839:Sdr16c5 UTSW 4 4006601 missense probably damaging 0.96
R3896:Sdr16c5 UTSW 4 4006609 missense probably damaging 1.00
R4824:Sdr16c5 UTSW 4 4016216 nonsense probably null
R5024:Sdr16c5 UTSW 4 4010365 missense probably damaging 1.00
R5194:Sdr16c5 UTSW 4 4006663 missense probably benign 0.16
R5395:Sdr16c5 UTSW 4 4016277 missense probably benign 0.12
R6267:Sdr16c5 UTSW 4 4016162 missense probably damaging 1.00
R7076:Sdr16c5 UTSW 4 4006591 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTTGTTCACATCCCAGAGAAC -3'
(R):5'- GTGACACATAGCTGGCATGC -3'

Sequencing Primer
(F):5'- AAGCACTGCTCCCAGGC -3'
(R):5'- CACATAGCTGGCATGCAGATCTTG -3'
Posted On2018-04-27