Incidental Mutation 'R6352:Pgd'
ID513274
Institutional Source Beutler Lab
Gene Symbol Pgd
Ensembl Gene ENSMUSG00000028961
Gene Namephosphogluconate dehydrogenase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R6352 (G1)
Quality Score170.009
Status Validated
Chromosome4
Chromosomal Location149149991-149166771 bp(-) (GRCm38)
Type of Mutationintron (83 bp from exon)
DNA Base Change (assembly) C to T at 149160752 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084124]
Predicted Effect probably null
Transcript: ENSMUST00000084124
SMART Domains Protein: ENSMUSP00000081141
Gene: ENSMUSG00000028961

DomainStartEndE-ValueType
Pfam:NAD_binding_2 3 176 3.2e-52 PFAM
6PGD 180 470 7.75e-219 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156120
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 6-phosphogluconate dehydrogenase is the second dehydrogenase in the pentose phosphate shunt. Deficiency of this enzyme is generally asymptomatic, and the inheritance of this disorder is autosomal dominant. Hemolysis results from combined deficiency of 6-phosphogluconate dehydrogenase and 6-phosphogluconolactonase suggesting a synergism of the two enzymopathies. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Pgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Pgd APN 4 149156753 missense probably damaging 1.00
IGL02480:Pgd APN 4 149156618 missense probably damaging 1.00
IGL03028:Pgd APN 4 149161627 critical splice donor site probably null
IGL03370:Pgd APN 4 149165228 missense probably damaging 1.00
R0398:Pgd UTSW 4 149153882 missense probably damaging 1.00
R0601:Pgd UTSW 4 149156810 splice site probably benign
R0980:Pgd UTSW 4 149154311 splice site probably null
R1475:Pgd UTSW 4 149156775 missense probably benign 0.00
R3826:Pgd UTSW 4 149166004 splice site probably benign
R4531:Pgd UTSW 4 149156777 missense probably benign 0.01
R4832:Pgd UTSW 4 149156591 intron probably benign
R6353:Pgd UTSW 4 149160752 intron probably null
R6485:Pgd UTSW 4 149156419 intron probably null
R6514:Pgd UTSW 4 149160752 intron probably null
R6519:Pgd UTSW 4 149150886 nonsense probably null
R6543:Pgd UTSW 4 149160752 intron probably null
R7153:Pgd UTSW 4 149161678 missense probably benign
Z1176:Pgd UTSW 4 149166679 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGCTGTGCAGTACTCTAAGAG -3'
(R):5'- TTTAGAGAAGATGCCGGGACC -3'

Sequencing Primer
(F):5'- GTGCAGTACTCTAAGAGATGCTCTC -3'
(R):5'- AGATGCCGGGACCTCAAG -3'
Posted On2018-04-27