Incidental Mutation 'R6352:Gbp8'
ID513279
Institutional Source Beutler Lab
Gene Symbol Gbp8
Ensembl Gene ENSMUSG00000034438
Gene Nameguanylate-binding protein 8
Synonyms5830443L24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105014150-105139540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105015060 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 489 (I489M)
Ref Sequence ENSEMBL: ENSMUSP00000108338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000112718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031235
AA Change: I489M

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438
AA Change: I489M

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112718
AA Change: I489M

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108338
Gene: ENSMUSG00000034438
AA Change: I489M

DomainStartEndE-ValueType
Pfam:GBP 16 214 5e-95 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199483
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Gbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Gbp8 APN 5 105017888 splice site probably benign
IGL00775:Gbp8 APN 5 105017845 missense probably damaging 0.96
IGL00788:Gbp8 APN 5 105050997 missense probably benign 0.32
IGL01289:Gbp8 APN 5 105017869 missense probably benign 0.01
IGL01634:Gbp8 APN 5 105018572 missense probably damaging 0.96
IGL03392:Gbp8 APN 5 105016544 critical splice donor site probably null
PIT4458001:Gbp8 UTSW 5 105015089 missense probably benign
R0180:Gbp8 UTSW 5 105031276 missense probably damaging 1.00
R0570:Gbp8 UTSW 5 105017675 splice site probably null
R1370:Gbp8 UTSW 5 105016576 missense possibly damaging 0.72
R1772:Gbp8 UTSW 5 105016121 missense probably benign 0.36
R2261:Gbp8 UTSW 5 105016133 missense possibly damaging 0.72
R2262:Gbp8 UTSW 5 105016133 missense possibly damaging 0.72
R4050:Gbp8 UTSW 5 105031238 missense probably damaging 1.00
R4405:Gbp8 UTSW 5 105051062 unclassified probably benign
R4649:Gbp8 UTSW 5 105041941 missense probably damaging 1.00
R4743:Gbp8 UTSW 5 105030841 missense possibly damaging 0.91
R5228:Gbp8 UTSW 5 105016185 missense probably benign 0.03
R5259:Gbp8 UTSW 5 105050979 missense probably benign 0.00
R5543:Gbp8 UTSW 5 105017830 missense possibly damaging 0.52
R5696:Gbp8 UTSW 5 105018816 missense possibly damaging 0.92
R6767:Gbp8 UTSW 5 105018612 missense probably benign 0.08
R6847:Gbp8 UTSW 5 105031227 missense probably benign 0.00
R7127:Gbp8 UTSW 5 105017712 missense probably benign 0.04
R7188:Gbp8 UTSW 5 105016215 missense probably benign 0.01
R7402:Gbp8 UTSW 5 105031295 missense probably damaging 1.00
R7461:Gbp8 UTSW 5 105031014 missense probably damaging 1.00
R7613:Gbp8 UTSW 5 105031014 missense probably damaging 1.00
R7724:Gbp8 UTSW 5 105031294 missense probably damaging 1.00
R8039:Gbp8 UTSW 5 105050917 nonsense probably null
R8146:Gbp8 UTSW 5 105030978 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TTCTCTGCGGAGTGAAAATGG -3'
(R):5'- TCTTCTTCATGGTAAGGGAAAGC -3'

Sequencing Primer
(F):5'- TTCTCTGCGGAGTGAAAATGGAAAAC -3'
(R):5'- CTTCATGGTAAGGGAAAGCTTTTAG -3'
Posted On2018-04-27