Incidental Mutation 'R6352:Cpt1c'
ID513283
Institutional Source Beutler Lab
Gene Symbol Cpt1c
Ensembl Gene ENSMUSG00000007783
Gene Namecarnitine palmitoyltransferase 1c
Synonyms9630004I06Rik, CPT I-C
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44959372-44974851 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 44966795 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063761] [ENSMUST00000211862] [ENSMUST00000212255] [ENSMUST00000212836]
Predicted Effect probably null
Transcript: ENSMUST00000063761
SMART Domains Protein: ENSMUSP00000069539
Gene: ENSMUSG00000007783

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.3e-21 PFAM
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 757 7.7e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207515
Predicted Effect probably benign
Transcript: ENSMUST00000211862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211901
Predicted Effect probably benign
Transcript: ENSMUST00000212255
Predicted Effect probably null
Transcript: ENSMUST00000212836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212890
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein regulates the beta-oxidation and transport of long-chain fatty acids into mitochondria, and may play a role in the regulation of feeding behavior and whole-body energy homeostasis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted mutations in this gene result in reduced body weight, increases in circulating fatty acid levels and mild insulin resistance. Mice homozygous for a different targeted knock-out exhibit reduced ceramide levels, impaired dendritic spine maturationand impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Cpt1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Cpt1c APN 7 44960909 missense probably damaging 0.98
IGL01111:Cpt1c APN 7 44965554 missense possibly damaging 0.90
IGL01153:Cpt1c APN 7 44966668 missense probably damaging 0.99
IGL02232:Cpt1c APN 7 44960156 missense probably damaging 0.99
R0046:Cpt1c UTSW 7 44959832 splice site probably benign
R0046:Cpt1c UTSW 7 44959832 splice site probably benign
R0141:Cpt1c UTSW 7 44966671 missense probably damaging 1.00
R0367:Cpt1c UTSW 7 44959575 missense probably benign
R0749:Cpt1c UTSW 7 44962826 missense probably damaging 1.00
R1384:Cpt1c UTSW 7 44960924 splice site probably benign
R1611:Cpt1c UTSW 7 44960112 missense probably benign 0.03
R3122:Cpt1c UTSW 7 44959921 missense probably damaging 1.00
R4892:Cpt1c UTSW 7 44959588 missense probably benign 0.14
R5175:Cpt1c UTSW 7 44971357 missense probably damaging 1.00
R6029:Cpt1c UTSW 7 44965124 missense probably benign 0.00
R6856:Cpt1c UTSW 7 44959918 missense probably damaging 1.00
R7621:Cpt1c UTSW 7 44967092 missense probably damaging 1.00
R7749:Cpt1c UTSW 7 44962265 missense probably benign 0.16
R7883:Cpt1c UTSW 7 44964014 splice site probably null
R8178:Cpt1c UTSW 7 44959653 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGACCAATGTTACTCCGTC -3'
(R):5'- TCAAGAACAAGCATGGCCTC -3'

Sequencing Primer
(F):5'- AAGCCAGCTAGAGTCCTGCTC -3'
(R):5'- ACAAGCATGGCCTCAGTGTATTTTG -3'
Posted On2018-04-27