Incidental Mutation 'R6352:Olfr703'
ID513284
Institutional Source Beutler Lab
Gene Symbol Olfr703
Ensembl Gene ENSMUSG00000073901
Gene Nameolfactory receptor 703
SynonymsMOR283-7, GA_x6K02T2PBJ9-9222217-9223176
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106843360-106846207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 106845222 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 204 (V204F)
Ref Sequence ENSEMBL: ENSMUSP00000149022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098142] [ENSMUST00000216254]
Predicted Effect probably damaging
Transcript: ENSMUST00000098142
AA Change: V204F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095746
Gene: ENSMUSG00000073901
AA Change: V204F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.8e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.4e-8 PFAM
Pfam:7tm_1 41 290 1.7e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216254
AA Change: V204F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Olfr703
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Olfr703 APN 7 106845367 missense possibly damaging 0.78
IGL01321:Olfr703 APN 7 106844749 missense probably damaging 1.00
IGL02169:Olfr703 APN 7 106845266 nonsense probably null
IGL03376:Olfr703 APN 7 106845470 missense probably damaging 1.00
R0045:Olfr703 UTSW 7 106845389 nonsense probably null
R0662:Olfr703 UTSW 7 106844649 missense probably benign 0.01
R1589:Olfr703 UTSW 7 106845196 missense possibly damaging 0.57
R1869:Olfr703 UTSW 7 106845094 missense probably benign 0.01
R2431:Olfr703 UTSW 7 106845391 missense possibly damaging 0.95
R4021:Olfr703 UTSW 7 106845019 missense probably damaging 1.00
R5280:Olfr703 UTSW 7 106844695 missense probably benign 0.01
R6932:Olfr703 UTSW 7 106844802 nonsense probably null
R7037:Olfr703 UTSW 7 106845336 missense probably damaging 1.00
R7909:Olfr703 UTSW 7 106844992 missense probably benign 0.29
R7990:Olfr703 UTSW 7 106844992 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ATATGGATCCTGGCATCAGTG -3'
(R):5'- GGATTCAGAGCTGGAGTGAC -3'

Sequencing Primer
(F):5'- ATCCTGGCATCAGTGATAGC -3'
(R):5'- TTGACTGGGAAGGACATACATG -3'
Posted On2018-04-27