Incidental Mutation 'R6352:Wdr11'
ID513285
Institutional Source Beutler Lab
Gene Symbol Wdr11
Ensembl Gene ENSMUSG00000042055
Gene NameWD repeat domain 11
SynonymsBrwd2, Wdr11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location129591863-129635738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129606675 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 385 (L385F)
Ref Sequence ENSEMBL: ENSMUSP00000081567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084519]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084519
AA Change: L385F

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081567
Gene: ENSMUSG00000042055
AA Change: L385F

DomainStartEndE-ValueType
WD40 50 99 2e-1 SMART
WD40 102 145 2.84e2 SMART
low complexity region 189 200 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 454 465 N/A INTRINSIC
WD40 552 595 4.42e1 SMART
WD40 696 735 1.66e0 SMART
WD40 737 777 1.43e1 SMART
WD40 780 821 1.38e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143849
Predicted Effect unknown
Transcript: ENSMUST00000148752
AA Change: L325F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149541
Predicted Effect probably benign
Transcript: ENSMUST00000206442
Meta Mutation Damage Score 0.2230 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is located in the chromosome 10q25-26 region, which is frequently deleted in gliomas and tumors of other tissues, and is disrupted by the t(10;19) translocation rearrangement in glioblastoma cells. The gene location suggests that it is a candidate gene for the tumor suppressor locus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Wdr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Wdr11 APN 7 129593093 splice site probably null
IGL01121:Wdr11 APN 7 129628022 missense probably benign 0.02
IGL01385:Wdr11 APN 7 129607913 missense probably benign
IGL01923:Wdr11 APN 7 129632322 critical splice acceptor site probably null
IGL02274:Wdr11 APN 7 129631172 critical splice acceptor site probably null
IGL02894:Wdr11 APN 7 129631166 splice site probably benign
IGL02927:Wdr11 APN 7 129607098 critical splice donor site probably null
IGL03008:Wdr11 APN 7 129606991 unclassified probably benign
IGL03026:Wdr11 APN 7 129624336 missense probably damaging 1.00
IGL03354:Wdr11 APN 7 129625302 missense probably benign 0.01
IGL03379:Wdr11 APN 7 129599123 missense probably damaging 1.00
propeller UTSW 7 129606675 missense possibly damaging 0.91
R0003:Wdr11 UTSW 7 129599061 missense probably damaging 1.00
R0928:Wdr11 UTSW 7 129606653 missense probably damaging 1.00
R1170:Wdr11 UTSW 7 129607107 unclassified probably benign
R1645:Wdr11 UTSW 7 129613889 missense probably benign 0.29
R1908:Wdr11 UTSW 7 129605230 missense possibly damaging 0.60
R1938:Wdr11 UTSW 7 129606607 missense probably benign 0.08
R2122:Wdr11 UTSW 7 129631766 missense probably damaging 1.00
R2148:Wdr11 UTSW 7 129629083 intron probably null
R2240:Wdr11 UTSW 7 129605694 critical splice acceptor site probably null
R2362:Wdr11 UTSW 7 129634836 missense probably benign 0.05
R3774:Wdr11 UTSW 7 129631693 splice site probably null
R4297:Wdr11 UTSW 7 129625186 missense probably benign 0.18
R4546:Wdr11 UTSW 7 129629005 missense probably damaging 1.00
R4787:Wdr11 UTSW 7 129608934 splice site probably benign
R4789:Wdr11 UTSW 7 129618670 nonsense probably null
R4807:Wdr11 UTSW 7 129628022 missense probably benign 0.02
R4855:Wdr11 UTSW 7 129600434 splice site probably null
R4898:Wdr11 UTSW 7 129633721 missense probably benign
R5022:Wdr11 UTSW 7 129624711 missense probably benign 0.10
R5326:Wdr11 UTSW 7 129625249 missense probably damaging 1.00
R5398:Wdr11 UTSW 7 129631232 missense probably damaging 1.00
R6120:Wdr11 UTSW 7 129624791 missense probably damaging 0.99
R6136:Wdr11 UTSW 7 129618703 missense possibly damaging 0.86
R6280:Wdr11 UTSW 7 129599106 nonsense probably null
R6432:Wdr11 UTSW 7 129606518 missense possibly damaging 0.83
R6766:Wdr11 UTSW 7 129624312 missense probably benign 0.02
R6911:Wdr11 UTSW 7 129607095 missense probably benign 0.28
R7135:Wdr11 UTSW 7 129628106 missense possibly damaging 0.76
R7151:Wdr11 UTSW 7 129606652 missense probably damaging 1.00
R7463:Wdr11 UTSW 7 129607086 missense probably damaging 0.99
R7503:Wdr11 UTSW 7 129603110 missense probably benign
R8097:Wdr11 UTSW 7 129607887 missense probably damaging 1.00
Z1177:Wdr11 UTSW 7 129607878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAAAGAGACTGTTTCCCCAG -3'
(R):5'- ACAGTGAAGCAACTGTCAGAAC -3'

Sequencing Primer
(F):5'- AGAGACTGTTTCCCCAGATCTAG -3'
(R):5'- GTGAAGCAACTGTCAGAACATAATC -3'
Posted On2018-04-27