Incidental Mutation 'R6352:Flt4'
ID513293
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene NameFMS-like tyrosine kinase 4
SynonymsVEGFR-3, Flt-4, VEGFR3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location49609263-49652739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49643506 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1168 (I1168T)
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
Predicted Effect probably benign
Transcript: ENSMUST00000020617
AA Change: I1168T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357
AA Change: I1168T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49635261 missense probably damaging 1.00
IGL01140:Flt4 APN 11 49634943 nonsense probably null
IGL01360:Flt4 APN 11 49643506 missense probably benign 0.04
IGL01386:Flt4 APN 11 49637335 missense probably benign 0.00
IGL01769:Flt4 APN 11 49635171 splice site probably benign
IGL02189:Flt4 APN 11 49626003 missense probably damaging 1.00
IGL02206:Flt4 APN 11 49630390 missense probably damaging 0.98
IGL02324:Flt4 APN 11 49645995 missense probably benign 0.13
IGL02433:Flt4 APN 11 49630573 missense probably benign 0.01
IGL03009:Flt4 APN 11 49627124 missense probably benign 0.02
IGL03035:Flt4 APN 11 49645897 nonsense probably null
IGL03059:Flt4 APN 11 49642307 missense probably damaging 0.97
IGL03350:Flt4 APN 11 49634793 nonsense probably null
PIT4802001:Flt4 UTSW 11 49633169 missense probably benign
R0360:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0364:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0386:Flt4 UTSW 11 49644386 missense probably benign 0.00
R0395:Flt4 UTSW 11 49630343 missense probably benign 0.00
R0600:Flt4 UTSW 11 49636339 splice site probably benign
R0666:Flt4 UTSW 11 49625447 missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49636339 splice site probably benign
R0734:Flt4 UTSW 11 49626717 missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49636339 splice site probably benign
R1013:Flt4 UTSW 11 49636339 splice site probably benign
R1103:Flt4 UTSW 11 49636339 splice site probably benign
R1104:Flt4 UTSW 11 49636339 splice site probably benign
R1162:Flt4 UTSW 11 49636339 splice site probably benign
R1241:Flt4 UTSW 11 49636339 splice site probably benign
R1401:Flt4 UTSW 11 49636339 splice site probably benign
R1487:Flt4 UTSW 11 49633144 missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49631981 missense probably benign 0.03
R1999:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2110:Flt4 UTSW 11 49625304 missense probably benign 0.03
R2150:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2189:Flt4 UTSW 11 49635698 missense probably benign 0.24
R2217:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2218:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2249:Flt4 UTSW 11 49645959 missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49637819 missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49634114 missense probably damaging 0.99
R3974:Flt4 UTSW 11 49636740 missense probably damaging 0.99
R4168:Flt4 UTSW 11 49630573 missense probably benign 0.01
R4700:Flt4 UTSW 11 49626444 intron probably benign
R4701:Flt4 UTSW 11 49626808 missense possibly damaging 0.49
R4714:Flt4 UTSW 11 49627207 missense probably damaging 0.99
R4817:Flt4 UTSW 11 49625415 missense probably damaging 0.98
R4921:Flt4 UTSW 11 49627143 missense probably damaging 0.98
R5066:Flt4 UTSW 11 49634163 missense possibly damaging 0.62
R5095:Flt4 UTSW 11 49627159 missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49633257 splice site probably null
R5245:Flt4 UTSW 11 49651034 frame shift probably null
R5250:Flt4 UTSW 11 49630400 missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49651034 frame shift probably null
R5401:Flt4 UTSW 11 49651034 frame shift probably null
R5402:Flt4 UTSW 11 49651034 frame shift probably null
R5527:Flt4 UTSW 11 49634754 missense probably damaging 1.00
R5686:Flt4 UTSW 11 49630603 missense probably benign 0.00
R5766:Flt4 UTSW 11 49626686 missense possibly damaging 0.75
R5996:Flt4 UTSW 11 49651070 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6361:Flt4 UTSW 11 49630578 missense probably benign 0.00
R6574:Flt4 UTSW 11 49625372 missense probably benign
R7205:Flt4 UTSW 11 49634298 missense probably null 0.78
R7216:Flt4 UTSW 11 49634681 missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49626009 missense probably benign 0.22
R7457:Flt4 UTSW 11 49630328 missense possibly damaging 0.89
R7559:Flt4 UTSW 11 49644371 missense possibly damaging 0.50
X0017:Flt4 UTSW 11 49626733 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCCAACTGCCATAGTGATCTAG -3'
(R):5'- TGCCCAGCTTCATGTTGAC -3'

Sequencing Primer
(F):5'- CTGCCATAGTGATCTAGGAGATGC -3'
(R):5'- CCCAGCTTCATGTTGACTGAGTTG -3'
Posted On2018-04-27