Incidental Mutation 'R6352:Rpl10a'
ID513304
Institutional Source Beutler Lab
Gene Symbol Rpl10a
Ensembl Gene ENSMUSG00000037805
Gene Nameribosomal protein L10A
SynonymsCsA-19, Nedd6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R6352 (G1)
Quality Score196.009
Status Validated
Chromosome17
Chromosomal Location28328471-28331032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28330846 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 167 (V167A)
Ref Sequence ENSEMBL: ENSMUSP00000048469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042334] [ENSMUST00000088007] [ENSMUST00000114799] [ENSMUST00000114801] [ENSMUST00000114803] [ENSMUST00000114804] [ENSMUST00000123248] [ENSMUST00000129935] [ENSMUST00000146104] [ENSMUST00000156505] [ENSMUST00000154873] [ENSMUST00000156862] [ENSMUST00000219703]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042334
AA Change: V167A

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048469
Gene: ENSMUSG00000037805
AA Change: V167A

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 12 213 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088007
SMART Domains Protein: ENSMUSP00000085322
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 212 5.9e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114799
SMART Domains Protein: ENSMUSP00000110447
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
TEA 52 123 9.04e-52 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 227 244 N/A INTRINSIC
PDB:3KYS|C 248 465 1e-120 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114801
SMART Domains Protein: ENSMUSP00000110449
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 7 98 1.8e-32 PFAM
Pfam:FA_FANCE 93 125 7.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114803
SMART Domains Protein: ENSMUSP00000110451
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 7 167 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114804
SMART Domains Protein: ENSMUSP00000110452
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 140 3.7e-56 PFAM
Pfam:FA_FANCE 137 170 6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123248
SMART Domains Protein: ENSMUSP00000119663
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 154 3.1e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128758
Predicted Effect probably benign
Transcript: ENSMUST00000129935
SMART Domains Protein: ENSMUSP00000114141
Gene: ENSMUSG00000037805

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 3 57 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152665
Predicted Effect probably benign
Transcript: ENSMUST00000146104
SMART Domains Protein: ENSMUSP00000114386
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 96 7.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156505
SMART Domains Protein: ENSMUSP00000118622
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 67 4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154873
SMART Domains Protein: ENSMUSP00000118582
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156862
SMART Domains Protein: ENSMUSP00000115443
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146668
Predicted Effect probably benign
Transcript: ENSMUST00000219703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151557
Meta Mutation Damage Score 0.4364 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L1P family of ribosomal proteins. It is located in the cytoplasm. The expression of this gene is downregulated in the thymus by cyclosporin-A (CsA), an immunosuppressive drug. Studies in mice have shown that the expression of the ribosomal protein L10a gene is downregulated in neural precursor cells during development. This gene previously was referred to as NEDD6 (neural precursor cell expressed, developmentally downregulated 6), but it has been renamed RPL10A (ribosomal protein 10a). As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Rpl10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Rpl10a APN 17 28329007 missense probably damaging 1.00
IGL02955:Rpl10a APN 17 28328993 missense probably damaging 0.99
R4106:Rpl10a UTSW 17 28330959 missense probably benign 0.01
R4921:Rpl10a UTSW 17 28330852 missense probably benign 0.15
R5057:Rpl10a UTSW 17 28330633 missense probably benign 0.00
R6932:Rpl10a UTSW 17 28329450 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCCCTGCTGACACACAATG -3'
(R):5'- AGCAGTGAGGTTTATTGGAGCATC -3'

Sequencing Primer
(F):5'- GGTGAAATCGACAATCAAGTTCC -3'
(R):5'- TTGGAGCATCCTAATACAGACGCTG -3'
Posted On2018-04-27