Incidental Mutation 'R6352:Ptk7'
ID513307
Institutional Source Beutler Lab
Gene Symbol Ptk7
Ensembl Gene ENSMUSG00000023972
Gene NamePTK7 protein tyrosine kinase 7
Synonyms8430404F20Rik, mPTK7/CCK4, chz
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46564451-46629504 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46576890 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 539 (W539R)
Ref Sequence ENSEMBL: ENSMUSP00000043703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044442]
Predicted Effect probably benign
Transcript: ENSMUST00000044442
AA Change: W539R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: W539R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Meta Mutation Damage Score 0.0706 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Ptk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ptk7 APN 17 46574427 missense probably damaging 1.00
IGL01064:Ptk7 APN 17 46573566 nonsense probably null
IGL01444:Ptk7 APN 17 46565387 missense probably damaging 1.00
IGL01477:Ptk7 APN 17 46576880 missense possibly damaging 0.61
IGL01727:Ptk7 APN 17 46572548 missense probably damaging 1.00
IGL01958:Ptk7 APN 17 46579427 missense probably benign 0.37
IGL02496:Ptk7 APN 17 46590144 missense probably benign 0.04
IGL02864:Ptk7 APN 17 46572733 missense probably damaging 1.00
R0008:Ptk7 UTSW 17 46572762 splice site probably benign
R0671:Ptk7 UTSW 17 46590312 missense possibly damaging 0.94
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1464:Ptk7 UTSW 17 46572591 missense probably damaging 1.00
R1549:Ptk7 UTSW 17 46572652 missense probably damaging 1.00
R1635:Ptk7 UTSW 17 46573534 missense possibly damaging 0.81
R1646:Ptk7 UTSW 17 46586297 missense probably benign 0.44
R1846:Ptk7 UTSW 17 46576490 critical splice donor site probably null
R1973:Ptk7 UTSW 17 46586807 nonsense probably null
R2060:Ptk7 UTSW 17 46566238 missense possibly damaging 0.83
R2155:Ptk7 UTSW 17 46579617 missense probably benign 0.09
R2472:Ptk7 UTSW 17 46576848 missense probably benign 0.35
R2937:Ptk7 UTSW 17 46572550 missense probably damaging 0.99
R3824:Ptk7 UTSW 17 46565378 missense probably damaging 1.00
R3845:Ptk7 UTSW 17 46586418 missense probably benign 0.00
R4222:Ptk7 UTSW 17 46574463 missense probably benign
R4671:Ptk7 UTSW 17 46574466 missense probably benign
R4922:Ptk7 UTSW 17 46576491 critical splice donor site probably null
R5319:Ptk7 UTSW 17 46572677 missense probably damaging 1.00
R5993:Ptk7 UTSW 17 46565370 missense probably benign
R6254:Ptk7 UTSW 17 46572642 missense probably damaging 1.00
R6806:Ptk7 UTSW 17 46573528 missense probably damaging 0.99
R7338:Ptk7 UTSW 17 46579599 missense probably benign 0.00
R7394:Ptk7 UTSW 17 46591757 missense probably damaging 1.00
R7709:Ptk7 UTSW 17 46571643 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TAGTGAGCAACGGAGCTGTC -3'
(R):5'- GCACAAGTGAAATGTTCTGGAGC -3'

Sequencing Primer
(F):5'- AAGGTAGGTTGTTACCCCCAG -3'
(R):5'- TAACAGGGGGCTTTGGACCAC -3'
Posted On2018-04-27