Incidental Mutation 'R6352:1700122O11Rik'
ID513308
Institutional Source Beutler Lab
Gene Symbol 1700122O11Rik
Ensembl Gene ENSMUSG00000094928
Gene NameRIKEN cDNA 1700122O11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location48036745-48038293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48037136 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 120 (S120G)
Ref Sequence ENSEMBL: ENSMUSP00000137519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178823]
Predicted Effect probably benign
Transcript: ENSMUST00000178823
AA Change: S120G

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137519
Gene: ENSMUSG00000094928
AA Change: S120G

DomainStartEndE-ValueType
coiled coil region 42 73 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in 1700122O11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02830:1700122O11Rik APN 17 48037426 missense possibly damaging 0.46
IGL02927:1700122O11Rik APN 17 48036920 nonsense probably null
R2013:1700122O11Rik UTSW 17 48036914 missense possibly damaging 0.53
R2014:1700122O11Rik UTSW 17 48036914 missense possibly damaging 0.53
R4698:1700122O11Rik UTSW 17 48038240 missense possibly damaging 0.46
R5194:1700122O11Rik UTSW 17 48037250 missense probably benign
R6512:1700122O11Rik UTSW 17 48036863 missense possibly damaging 0.83
R7546:1700122O11Rik UTSW 17 48037521 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTGTCTTGGGCATAGTAG -3'
(R):5'- GCCTCACTCTATGACCATATCGG -3'

Sequencing Primer
(F):5'- CCTGTCTTGGGCATAGTAGATCTC -3'
(R):5'- ATATCGGTCCGCTGCCC -3'
Posted On2018-04-27