Incidental Mutation 'R6352:Wdr74'
ID513310
Institutional Source Beutler Lab
Gene Symbol Wdr74
Ensembl Gene ENSMUSG00000042729
Gene NameWD repeat domain 74
Synonyms5730436H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6352 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8735827-8740624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8739458 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 200 (V200A)
Ref Sequence ENSEMBL: ENSMUSP00000147765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010254] [ENSMUST00000049424] [ENSMUST00000073430] [ENSMUST00000163172] [ENSMUST00000175872] [ENSMUST00000175901] [ENSMUST00000176013] [ENSMUST00000176314] [ENSMUST00000176381] [ENSMUST00000177322] [ENSMUST00000177373] [ENSMUST00000210512] [ENSMUST00000210592]
Predicted Effect probably benign
Transcript: ENSMUST00000010254
SMART Domains Protein: ENSMUSP00000010254
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin-5_N 52 74 1.5e-15 PFAM
SCOP:d1fioa_ 92 298 7e-36 SMART
Blast:t_SNARE 258 304 9e-22 BLAST
low complexity region 346 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049424
AA Change: V244A

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043315
Gene: ENSMUSG00000042729
AA Change: V244A

DomainStartEndE-ValueType
WD40 32 71 9.94e-1 SMART
Blast:WD40 76 113 1e-16 BLAST
WD40 120 159 1.85e0 SMART
Blast:WD40 175 211 2e-16 BLAST
Blast:WD40 214 255 2e-14 BLAST
WD40 258 297 2.8e-3 SMART
low complexity region 326 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073430
SMART Domains Protein: ENSMUSP00000073136
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175642
Predicted Effect probably benign
Transcript: ENSMUST00000175872
SMART Domains Protein: ENSMUSP00000135416
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 2.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175901
SMART Domains Protein: ENSMUSP00000134951
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176009
Predicted Effect probably benign
Transcript: ENSMUST00000176013
SMART Domains Protein: ENSMUSP00000135465
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 143 3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176260
Predicted Effect probably benign
Transcript: ENSMUST00000176314
SMART Domains Protein: ENSMUSP00000135348
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176381
SMART Domains Protein: ENSMUSP00000134854
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177322
SMART Domains Protein: ENSMUSP00000135624
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177373
SMART Domains Protein: ENSMUSP00000134794
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
Pfam:Syntaxin 1 98 5.2e-15 PFAM
t_SNARE 162 229 4.33e-15 SMART
transmembrane domain 238 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187020
Predicted Effect possibly damaging
Transcript: ENSMUST00000210512
AA Change: V200A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000210592
AA Change: V244A

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.1062 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Klf9 T A 19: 23,141,774 M7K probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Other mutations in Wdr74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Wdr74 APN 19 8739466 missense possibly damaging 0.58
IGL01832:Wdr74 APN 19 8739938 missense probably damaging 0.99
IGL03051:Wdr74 APN 19 8739511 splice site probably benign
R1456:Wdr74 UTSW 19 8740412 missense probably benign 0.00
R1481:Wdr74 UTSW 19 8738228 missense possibly damaging 0.93
R1932:Wdr74 UTSW 19 8737947 missense probably benign 0.00
R4876:Wdr74 UTSW 19 8739485 missense possibly damaging 0.95
R5643:Wdr74 UTSW 19 8737876 missense probably damaging 1.00
R5644:Wdr74 UTSW 19 8737876 missense probably damaging 1.00
R5927:Wdr74 UTSW 19 8739833 missense possibly damaging 0.65
R6735:Wdr74 UTSW 19 8736222 missense possibly damaging 0.89
R7516:Wdr74 UTSW 19 8736190 nonsense probably null
Z1176:Wdr74 UTSW 19 8739297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCGTGTCTATGATCCAGTC -3'
(R):5'- GGCATGGGTGTTAGCTAACC -3'

Sequencing Primer
(F):5'- GTGTCTATGATCCAGTCTCCCC -3'
(R):5'- GCTAACCAGCCACTGAATATGTAG -3'
Posted On2018-04-27