Incidental Mutation 'R6352:Klf9'
ID513312
Institutional Source Beutler Lab
Gene Symbol Klf9
Ensembl Gene ENSMUSG00000033863
Gene NameKruppel-like factor 9
SynonymsBteb1, BTEB-1, Klf9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6352 (G1)
Quality Score189.009
Status Validated
Chromosome19
Chromosomal Location23141226-23166911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23141774 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 7 (M7K)
Ref Sequence ENSEMBL: ENSMUSP00000045639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036884]
Predicted Effect probably benign
Transcript: ENSMUST00000036884
AA Change: M7K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045639
Gene: ENSMUSG00000033863
AA Change: M7K

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
ZnF_C2H2 143 167 1.04e-3 SMART
ZnF_C2H2 173 197 7.37e-4 SMART
ZnF_C2H2 203 225 3.16e-3 SMART
Meta Mutation Damage Score 0.0951 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds to GC box elements located in the promoter. Binding of the encoded protein to a single GC box inhibits mRNA expression while binding to tandemly repeated GC box elements activates transcription. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display only mild neurological defects evident by impaired performance in rotarod and contextual fear-conditioning tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,136 S120G probably benign Het
Abca13 G A 11: 9,309,139 probably null Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adgra3 T A 5: 49,979,136 D669V probably benign Het
Adgra3 T A 5: 49,990,250 M483L probably benign Het
BC005561 A G 5: 104,520,198 E862G probably benign Het
Ccdc42 T C 11: 68,594,365 V88A probably damaging Het
Cdh16 G C 8: 104,616,992 S624C probably damaging Het
Cpt1c A T 7: 44,966,795 probably null Het
Cul9 T C 17: 46,511,315 T1795A probably benign Het
Dnah2 C T 11: 69,448,227 V3098I probably damaging Het
Fam126b A G 1: 58,557,312 V38A probably damaging Het
Fbxl16 T C 17: 25,818,945 L426P probably damaging Het
Flt4 T C 11: 49,643,506 I1168T probably benign Het
Fmo5 T C 3: 97,645,675 V313A probably benign Het
Foxj3 A G 4: 119,585,778 N133S probably damaging Het
Gbp8 T C 5: 105,015,060 I489M possibly damaging Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Hdgfl1 T G 13: 26,769,750 E113D probably benign Het
Heatr5a A T 12: 51,951,166 S317T possibly damaging Het
Insr C T 8: 3,173,479 probably null Het
Iqcf5 A G 9: 106,515,730 E62G possibly damaging Het
Kcnj3 G A 2: 55,437,549 V117I probably benign Het
Mboat1 G A 13: 30,202,420 G139E possibly damaging Het
Mical3 T C 6: 120,952,473 T1811A probably damaging Het
Mllt10 A C 2: 18,123,793 K117T probably damaging Het
Mpped1 A G 15: 83,836,363 D8G probably damaging Het
Myh4 A T 11: 67,252,282 D1012V probably damaging Het
Myo9b C A 8: 71,348,410 P1070T probably benign Het
Myo9b C T 8: 71,348,411 P1071L probably benign Het
Nlrp1b T A 11: 71,181,701 I439F probably damaging Het
Nlrp9a T A 7: 26,557,626 I134N probably damaging Het
Nop2 C T 6: 125,137,207 T212M probably benign Het
Notch4 T C 17: 34,567,461 C188R probably damaging Het
Olfr1495 A T 19: 13,768,464 M41L probably benign Het
Olfr703 G T 7: 106,845,222 V204F probably damaging Het
Pgd C T 4: 149,160,752 probably null Het
Plet1 T C 9: 50,501,107 S142P probably damaging Het
Ptk7 A T 17: 46,576,890 W539R probably benign Het
Ptprd A T 4: 76,091,552 probably null Het
Rgs22 T G 15: 36,092,921 Q402P probably damaging Het
Rpl10a T C 17: 28,330,846 V167A possibly damaging Het
Sdr16c5 A G 4: 4,016,421 S2P probably benign Het
Slc14a2 T C 18: 78,209,094 M1V probably null Het
Spta1 T A 1: 174,211,646 M1185K possibly damaging Het
Syde2 G T 3: 145,998,474 E127* probably null Het
Ugt2b38 T A 5: 87,424,001 R57S possibly damaging Het
Wdr11 C T 7: 129,606,675 L385F possibly damaging Het
Wdr74 T C 19: 8,739,458 V200A possibly damaging Het
Other mutations in Klf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Klf9 APN 19 23142269 splice site probably benign
R0399:Klf9 UTSW 19 23142082 missense probably damaging 0.96
R0528:Klf9 UTSW 19 23142134 missense probably benign 0.00
R1883:Klf9 UTSW 19 23164737 missense probably damaging 1.00
R2113:Klf9 UTSW 19 23164688 missense probably damaging 1.00
R5642:Klf9 UTSW 19 23141882 missense probably benign
R6560:Klf9 UTSW 19 23141950 missense probably damaging 0.97
R6618:Klf9 UTSW 19 23164871 missense probably benign 0.11
X0067:Klf9 UTSW 19 23164764 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCGGTTACGTAAAGATGAG -3'
(R):5'- TATCCTCATCGGGACTCTCCAG -3'

Sequencing Primer
(F):5'- ATGAGGGGCTGAGGTCGC -3'
(R):5'- TGAGGTCCAACAAGCTCTTG -3'
Posted On2018-04-27