Incidental Mutation 'R6358:Car14'
ID513322
Institutional Source Beutler Lab
Gene Symbol Car14
Ensembl Gene ENSMUSG00000038526
Gene Namecarbonic anhydrase 14
SynonymsCA XIV
MMRRC Submission
Accession Numbers

Genbank: NM_011797; MGI: 1344341

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95897768-95904691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95898175 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 329 (T329S)
Ref Sequence ENSEMBL: ENSMUSP00000036983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015894] [ENSMUST00000036181] [ENSMUST00000056710] [ENSMUST00000147962] [ENSMUST00000197081]
PDB Structure
Crystal Structure of the Extracellular Domain of Murine Carbonic Anhydrase XIV [X-RAY DIFFRACTION]
Crystal Structure of the Extracellular Domain of Murine Carbonic Anhydrase XIV in Complex with Acetazolamide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015894
SMART Domains Protein: ENSMUSP00000015894
Gene: ENSMUSG00000015750

DomainStartEndE-ValueType
Pfam:Aph-1 2 246 7.3e-98 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000036181
AA Change: T329S

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036983
Gene: ENSMUSG00000038526
AA Change: T329S

DomainStartEndE-ValueType
Carb_anhydrase 22 278 2.43e-123 SMART
transmembrane domain 290 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056710
SMART Domains Protein: ENSMUSP00000058846
Gene: ENSMUSG00000015750

DomainStartEndE-ValueType
Pfam:Aph-1 2 239 1.2e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126722
Predicted Effect probably benign
Transcript: ENSMUST00000147962
SMART Domains Protein: ENSMUSP00000117464
Gene: ENSMUSG00000038526

DomainStartEndE-ValueType
Carb_anhydrase 8 171 1.79e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149202
Predicted Effect probably benign
Transcript: ENSMUST00000197081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197232
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XIV is predicted to be a type I membrane protein and shares highest sequence similarity with the other transmembrane CA isoform, CA XII; however, they have different patterns of tissue-specific expression and thus may play different physiologic roles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and display normal growth, health and fertility. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Car14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Car14 APN 3 95898816 missense probably damaging 1.00
IGL01287:Car14 APN 3 95899559 missense possibly damaging 0.68
IGL01900:Car14 APN 3 95901221 missense probably benign 0.00
IGL02402:Car14 APN 3 95899558 missense possibly damaging 0.92
IGL03152:Car14 APN 3 95898845 missense probably damaging 1.00
R0109:Car14 UTSW 3 95899451 missense probably benign 0.00
R1729:Car14 UTSW 3 95901248 missense possibly damaging 0.90
R4521:Car14 UTSW 3 95904378 utr 5 prime probably benign
R4776:Car14 UTSW 3 95898873 missense probably benign 0.30
R5709:Car14 UTSW 3 95898988 missense possibly damaging 0.60
R6895:Car14 UTSW 3 95898160 missense probably benign
R7217:Car14 UTSW 3 95899317 missense probably damaging 1.00
R7648:Car14 UTSW 3 95898195 missense probably benign 0.01
R7763:Car14 UTSW 3 95904372 start codon destroyed probably null 0.01
X0026:Car14 UTSW 3 95899209 unclassified probably benign
X0064:Car14 UTSW 3 95901099 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGAGCTGGGGTCCCTG -3'
(R):5'- GAGATCCTACTTTCTATTCCTGCAG -3'

Sequencing Primer
(F):5'- CCCTGGTGTATAGAGAGGGTTACC -3'
(R):5'- GCTAGTCACTCCCATGAA -3'
Posted On2018-04-27