Incidental Mutation 'R6358:Magi3'
ID513323
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms4732496O19Rik, 6530407C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location104013259-104220374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104050952 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 606 (M606V)
Ref Sequence ENSEMBL: ENSMUSP00000113713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303]
Predicted Effect probably damaging
Transcript: ENSMUST00000064371
AA Change: M606V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: M606V

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121198
AA Change: M606V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: M606V

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122303
AA Change: M606V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: M606V

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 104014978 missense probably damaging 1.00
IGL00933:Magi3 APN 3 104015847 missense probably benign
IGL01151:Magi3 APN 3 104051374 missense probably damaging 1.00
IGL01674:Magi3 APN 3 104105721 splice site probably benign
IGL01790:Magi3 APN 3 104085244 missense probably damaging 1.00
IGL01903:Magi3 APN 3 104051210 missense possibly damaging 0.87
IGL01939:Magi3 APN 3 104054462 missense probably damaging 0.99
IGL02142:Magi3 APN 3 104015903 missense probably benign 0.32
IGL02183:Magi3 APN 3 104085347 missense probably benign 0.01
IGL02887:Magi3 APN 3 104095157 missense probably damaging 1.00
IGL03071:Magi3 APN 3 104015886 missense possibly damaging 0.51
IGL03085:Magi3 APN 3 104015339 missense possibly damaging 0.88
IGL03192:Magi3 APN 3 104043246 missense probably damaging 1.00
IGL03204:Magi3 APN 3 104105835 missense probably damaging 1.00
IGL03227:Magi3 APN 3 104051119 missense probably benign
IGL03388:Magi3 APN 3 104015841 missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 104054352 missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 104015526 missense probably benign 0.05
R0092:Magi3 UTSW 3 104050964 nonsense probably null
R0514:Magi3 UTSW 3 104015022 missense probably damaging 1.00
R0569:Magi3 UTSW 3 104016042 missense probably benign 0.43
R0608:Magi3 UTSW 3 104017557 missense probably damaging 1.00
R0920:Magi3 UTSW 3 104034191 splice site probably null
R1173:Magi3 UTSW 3 104061630 critical splice donor site probably null
R1256:Magi3 UTSW 3 104027810 missense probably benign 0.08
R1391:Magi3 UTSW 3 104015058 nonsense probably null
R1559:Magi3 UTSW 3 104046853 splice site probably benign
R1568:Magi3 UTSW 3 104089527 missense probably benign 0.02
R1631:Magi3 UTSW 3 104051177 missense probably benign 0.05
R1747:Magi3 UTSW 3 104034173 missense possibly damaging 0.82
R1930:Magi3 UTSW 3 104089604 missense probably damaging 1.00
R1964:Magi3 UTSW 3 104020402 missense probably damaging 0.99
R2151:Magi3 UTSW 3 104046882 missense probably damaging 1.00
R2151:Magi3 UTSW 3 104085238 missense probably damaging 1.00
R2266:Magi3 UTSW 3 104021066 intron probably benign
R2267:Magi3 UTSW 3 104021066 intron probably benign
R2268:Magi3 UTSW 3 104021066 intron probably benign
R2519:Magi3 UTSW 3 104015765 missense probably benign 0.00
R3104:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3105:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3619:Magi3 UTSW 3 104054405 missense probably damaging 1.00
R4158:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4160:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4284:Magi3 UTSW 3 104015868 nonsense probably null
R4285:Magi3 UTSW 3 104015868 nonsense probably null
R4397:Magi3 UTSW 3 104219714 missense probably damaging 1.00
R4512:Magi3 UTSW 3 104089555 missense probably damaging 0.99
R4676:Magi3 UTSW 3 104015825 missense probably benign
R4758:Magi3 UTSW 3 104015321 missense probably benign 0.01
R4940:Magi3 UTSW 3 104051392 missense probably damaging 1.00
R5039:Magi3 UTSW 3 104105791 missense probably damaging 1.00
R5160:Magi3 UTSW 3 104027908 missense possibly damaging 0.46
R5422:Magi3 UTSW 3 104051368 missense probably damaging 1.00
R5509:Magi3 UTSW 3 104015502 missense probably benign 0.00
R5839:Magi3 UTSW 3 104219731 missense probably damaging 1.00
R5924:Magi3 UTSW 3 104054538 splice site probably null
R6018:Magi3 UTSW 3 104105812 missense probably damaging 1.00
R6189:Magi3 UTSW 3 104050865 missense probably damaging 1.00
R6235:Magi3 UTSW 3 104016068 missense probably damaging 0.99
R6244:Magi3 UTSW 3 104015697 missense probably benign 0.16
R6258:Magi3 UTSW 3 104089596 missense probably damaging 1.00
R6534:Magi3 UTSW 3 104085220 missense possibly damaging 0.75
R6806:Magi3 UTSW 3 104046969 missense possibly damaging 0.94
R6816:Magi3 UTSW 3 104089911 intron probably null
R6897:Magi3 UTSW 3 104089557 missense probably damaging 1.00
R7011:Magi3 UTSW 3 104105754 missense probably damaging 1.00
R7039:Magi3 UTSW 3 104051383 missense probably damaging 1.00
R7196:Magi3 UTSW 3 104049168 missense probably benign 0.01
R7237:Magi3 UTSW 3 104027911 missense probably damaging 1.00
R7285:Magi3 UTSW 3 104034114 missense probably benign 0.00
R7709:Magi3 UTSW 3 104034038 missense probably damaging 1.00
R7724:Magi3 UTSW 3 104015927 missense probably benign 0.04
R7797:Magi3 UTSW 3 104051302 missense probably damaging 1.00
X0026:Magi3 UTSW 3 104020420 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTGCCAGGGAAATCTGCC -3'
(R):5'- ATCTTGGCCAGTGATCGTC -3'

Sequencing Primer
(F):5'- AGAGTCATCCTCGGGTGTTACTC -3'
(R):5'- GTCTCAATGGTCCATCTGAGTCAAG -3'
Posted On2018-04-27