Incidental Mutation 'R6358:Tmem167b'
ID513324
Institutional Source Beutler Lab
Gene Symbol Tmem167b
Ensembl Gene ENSMUSG00000068732
Gene Nametransmembrane protein 167B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location108556425-108562466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108558895 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 79 (R79H)
Ref Sequence ENSEMBL: ENSMUSP00000102233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090546] [ENSMUST00000106622]
Predicted Effect probably benign
Transcript: ENSMUST00000090546
AA Change: V70I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088035
Gene: ENSMUSG00000068732
AA Change: V70I

DomainStartEndE-ValueType
Pfam:DUF1242 10 46 7.6e-14 PFAM
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106622
AA Change: R79H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102233
Gene: ENSMUSG00000068732
AA Change: R79H

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 58 78 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199996
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Tmem167b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Tmem167b APN 3 108558906 missense possibly damaging 0.82
R0847:Tmem167b UTSW 3 108560221 missense probably benign
R5310:Tmem167b UTSW 3 108562099 intron probably benign
R5524:Tmem167b UTSW 3 108560253 missense possibly damaging 0.84
R5808:Tmem167b UTSW 3 108560243 missense probably benign 0.27
R6093:Tmem167b UTSW 3 108562123 start codon destroyed probably null
R7716:Tmem167b UTSW 3 108558897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGTTTCCCCACATATGGC -3'
(R):5'- GGGTAAGCAATCCATGTAGAGC -3'

Sequencing Primer
(F):5'- TTTCCCCACATATGGCAGGCAG -3'
(R):5'- GCAATCCATGTAGAGCCTAGAGC -3'
Posted On2018-04-27