Incidental Mutation 'R6358:D5Ertd579e'
ID513330
Institutional Source Beutler Lab
Gene Symbol D5Ertd579e
Ensembl Gene ENSMUSG00000029190
Gene NameDNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location36600485-36696024 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 36616236 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031091]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031091
AA Change: R272W

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031091
Gene: ENSMUSG00000029190
AA Change: R272W

DomainStartEndE-ValueType
Pfam:DUF4603 23 1303 N/A PFAM
low complexity region 1365 1376 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132383
SMART Domains Protein: ENSMUSP00000116548
Gene: ENSMUSG00000029190

DomainStartEndE-ValueType
Pfam:DUF4603 1 1181 N/A PFAM
low complexity region 1243 1254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140063
SMART Domains Protein: ENSMUSP00000118804
Gene: ENSMUSG00000029190

DomainStartEndE-ValueType
Pfam:DUF4603 23 77 1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201187
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in D5Ertd579e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:D5Ertd579e APN 5 36618754 missense probably damaging 0.99
IGL01925:D5Ertd579e APN 5 36614284 missense possibly damaging 0.67
IGL01933:D5Ertd579e APN 5 36615756 missense probably benign
IGL02164:D5Ertd579e APN 5 36614959 missense probably damaging 1.00
IGL02399:D5Ertd579e APN 5 36616185 missense probably damaging 1.00
IGL02896:D5Ertd579e APN 5 36613982 missense possibly damaging 0.70
IGL03141:D5Ertd579e APN 5 36613277 missense possibly damaging 0.94
IGL03235:D5Ertd579e APN 5 36618828 splice site probably benign
R0201:D5Ertd579e UTSW 5 36616465 missense probably damaging 1.00
R0377:D5Ertd579e UTSW 5 36604567 missense probably benign 0.12
R0830:D5Ertd579e UTSW 5 36613757 missense probably damaging 1.00
R0926:D5Ertd579e UTSW 5 36672866 missense probably damaging 1.00
R1350:D5Ertd579e UTSW 5 36613737 missense probably damaging 1.00
R1448:D5Ertd579e UTSW 5 36602739 missense probably benign
R1672:D5Ertd579e UTSW 5 36613277 missense possibly damaging 0.50
R1676:D5Ertd579e UTSW 5 36616109 missense probably benign 0.01
R1693:D5Ertd579e UTSW 5 36614097 missense probably damaging 0.98
R1698:D5Ertd579e UTSW 5 36604530 missense probably benign
R1868:D5Ertd579e UTSW 5 36616427 missense probably damaging 0.99
R1909:D5Ertd579e UTSW 5 36614058 missense probably benign 0.21
R2034:D5Ertd579e UTSW 5 36613538 nonsense probably null
R2080:D5Ertd579e UTSW 5 36616206 missense probably benign 0.01
R2105:D5Ertd579e UTSW 5 36613449 missense probably benign 0.12
R2197:D5Ertd579e UTSW 5 36614793 missense possibly damaging 0.69
R4212:D5Ertd579e UTSW 5 36614479 missense probably damaging 0.99
R4452:D5Ertd579e UTSW 5 36616470 missense probably damaging 1.00
R4626:D5Ertd579e UTSW 5 36614559 missense possibly damaging 0.92
R4804:D5Ertd579e UTSW 5 36629652 splice site probably null
R4898:D5Ertd579e UTSW 5 36614941 missense probably damaging 0.99
R4917:D5Ertd579e UTSW 5 36615816 missense probably damaging 1.00
R4960:D5Ertd579e UTSW 5 36616227 nonsense probably null
R4973:D5Ertd579e UTSW 5 36672905 missense probably benign
R5092:D5Ertd579e UTSW 5 36602703 missense probably benign 0.18
R5474:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5475:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5476:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5477:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5801:D5Ertd579e UTSW 5 36604569 missense probably damaging 1.00
R6019:D5Ertd579e UTSW 5 36629692 missense possibly damaging 0.90
R6184:D5Ertd579e UTSW 5 36629783 missense probably damaging 0.99
R6213:D5Ertd579e UTSW 5 36602634 missense probably damaging 1.00
R6244:D5Ertd579e UTSW 5 36615276 missense probably damaging 0.98
R6276:D5Ertd579e UTSW 5 36604514 missense possibly damaging 0.66
R6285:D5Ertd579e UTSW 5 36615577 missense probably damaging 1.00
R6875:D5Ertd579e UTSW 5 36604657 splice site probably null
R6967:D5Ertd579e UTSW 5 36615756 missense probably benign
R7139:D5Ertd579e UTSW 5 36613976 missense probably damaging 1.00
R7329:D5Ertd579e UTSW 5 36616395 missense probably benign 0.21
R7464:D5Ertd579e UTSW 5 36613785 missense probably damaging 0.99
R7664:D5Ertd579e UTSW 5 36614617 missense probably benign 0.00
R7762:D5Ertd579e UTSW 5 36613381 missense
R7951:D5Ertd579e UTSW 5 36615173 missense probably benign
R8175:D5Ertd579e UTSW 5 36615470 missense probably damaging 1.00
R8217:D5Ertd579e UTSW 5 36614058 missense probably benign 0.00
R8233:D5Ertd579e UTSW 5 36615244 missense probably damaging 0.99
R8281:D5Ertd579e UTSW 5 36613320 missense
R8398:D5Ertd579e UTSW 5 36614277 nonsense probably null
RF022:D5Ertd579e UTSW 5 36614662 missense probably damaging 1.00
X0019:D5Ertd579e UTSW 5 36613958 missense probably damaging 1.00
Z1176:D5Ertd579e UTSW 5 36615762 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTGAATGCCTGTTTTGCCC -3'
(R):5'- GGAACAAGTCCAAACCCTGTTC -3'

Sequencing Primer
(F):5'- GAATGCCTGTTTTGCCCATTCC -3'
(R):5'- AAGTCCAAACCCTGTTCTTACTCTAG -3'
Posted On2018-04-27