Incidental Mutation 'R6358:Hsd3b7'
ID 513338
Institutional Source Beutler Lab
Gene Symbol Hsd3b7
Ensembl Gene ENSMUSG00000042289
Gene Name hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Synonyms
MMRRC Submission 044508-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6358 (G1)
Quality Score 223.009
Status Validated
Chromosome 7
Chromosomal Location 127399830-127402975 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127400709 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 54 (H54Q)
Ref Sequence ENSEMBL: ENSMUSP00000145613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046863] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000106267] [ENSMUST00000106271] [ENSMUST00000106272] [ENSMUST00000125188] [ENSMUST00000155005] [ENSMUST00000138432] [ENSMUST00000139068] [ENSMUST00000206674] [ENSMUST00000154987]
AlphaFold Q9EQC1
Predicted Effect possibly damaging
Transcript: ENSMUST00000046863
AA Change: H81Q

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036245
Gene: ENSMUSG00000042289
AA Change: H81Q

DomainStartEndE-ValueType
Pfam:KR 11 147 3e-10 PFAM
Pfam:RmlD_sub_bind 11 198 8.1e-10 PFAM
Pfam:Polysacc_synt_2 12 140 4.6e-13 PFAM
Pfam:NmrA 12 142 1.9e-9 PFAM
Pfam:Epimerase 12 215 3.2e-25 PFAM
Pfam:GDP_Man_Dehyd 13 185 8.1e-17 PFAM
Pfam:3Beta_HSD 13 290 5.4e-99 PFAM
Pfam:NAD_binding_4 14 240 1.4e-15 PFAM
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047075
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047157
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106267
SMART Domains Protein: ENSMUSP00000101874
Gene: ENSMUSG00000030806

DomainStartEndE-ValueType
SynN 24 145 1.99e-44 SMART
t_SNARE 186 253 4.32e-24 SMART
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106271
AA Change: H81Q

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101878
Gene: ENSMUSG00000042289
AA Change: H81Q

DomainStartEndE-ValueType
Pfam:adh_short 10 143 1.3e-13 PFAM
Pfam:RmlD_sub_bind 10 186 3.7e-10 PFAM
Pfam:KR 11 140 5.7e-10 PFAM
Pfam:Polysacc_synt_2 12 140 2.8e-13 PFAM
Pfam:NmrA 12 141 2.7e-9 PFAM
Pfam:Epimerase 12 220 2.9e-26 PFAM
Pfam:NAD_binding_10 13 186 2.3e-11 PFAM
Pfam:3Beta_HSD 13 216 1e-70 PFAM
Pfam:NAD_binding_4 14 183 1.3e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106272
AA Change: H81Q

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101879
Gene: ENSMUSG00000042289
AA Change: H81Q

DomainStartEndE-ValueType
Pfam:adh_short 10 143 3.7e-13 PFAM
Pfam:RmlD_sub_bind 10 180 2.8e-9 PFAM
Pfam:KR 11 139 1.6e-9 PFAM
Pfam:Polysacc_synt_2 12 140 7.7e-13 PFAM
Pfam:NmrA 12 141 7.3e-9 PFAM
Pfam:Epimerase 12 215 7.1e-26 PFAM
Pfam:NAD_binding_10 13 179 1.1e-10 PFAM
Pfam:3Beta_HSD 13 188 6.1e-70 PFAM
Pfam:NAD_binding_4 14 187 1.5e-17 PFAM
Pfam:3Beta_HSD 177 261 4e-23 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125188
AA Change: H54Q

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206516
Predicted Effect probably benign
Transcript: ENSMUST00000155005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144748
Predicted Effect probably benign
Transcript: ENSMUST00000136823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124631
Predicted Effect probably benign
Transcript: ENSMUST00000138432
SMART Domains Protein: ENSMUSP00000114536
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 18 78 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139068
SMART Domains Protein: ENSMUSP00000121246
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 13 55 2.7e-13 PFAM
Pfam:3Beta_HSD 53 100 3.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206674
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206995
Meta Mutation Damage Score 0.0831 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which is involved in the initial stages of the synthesis of bile acids from cholesterol and a member of the short-chain dehydrogenase/reductase superfamily. The encoded protein is a membrane-associated endoplasmic reticulum protein which is active against 7-alpha hydrosylated sterol substrates. Mutations in this gene are associated with a congenital bile acid synthesis defect which leads to neonatal cholestasis, a form of progressive liver disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, dwarfism, growth retardation, oily and scaly skin, and altered bile salt and lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 41,279,718 (GRCm39) V703A probably benign Het
Adgrv1 T A 13: 81,562,702 (GRCm39) Q5389L probably damaging Het
Aldh18a1 A T 19: 40,566,122 (GRCm39) I42N possibly damaging Het
Ankrd28 A C 14: 31,432,821 (GRCm39) C575W probably damaging Het
Car14 T A 3: 95,805,487 (GRCm39) T329S possibly damaging Het
Cdhr2 T C 13: 54,884,359 (GRCm39) F1298S probably damaging Het
Crhr2 A G 6: 55,070,028 (GRCm39) I341T probably benign Het
D5Ertd579e T A 5: 36,773,580 (GRCm39) probably null Het
Eif1ad3 A G 12: 87,843,770 (GRCm39) E139G unknown Het
Emilin1 A G 5: 31,075,562 (GRCm39) E601G probably damaging Het
Erbin T A 13: 103,982,073 (GRCm39) Q456L probably damaging Het
Glp1r T C 17: 31,151,618 (GRCm39) V405A probably benign Het
Gm10220 C G 5: 26,325,303 (GRCm39) probably null Het
Gm527 A T 12: 64,970,322 (GRCm39) H219L possibly damaging Het
Gorasp2 T A 2: 70,503,104 (GRCm39) M1K probably null Het
H2-DMa T A 17: 34,356,958 (GRCm39) L152H probably damaging Het
Hspa12b T C 2: 130,978,986 (GRCm39) probably benign Het
Iars1 C A 13: 49,880,619 (GRCm39) T1006K possibly damaging Het
Jmjd1c T C 10: 67,061,718 (GRCm39) V1357A probably benign Het
Magi3 T C 3: 103,958,268 (GRCm39) M606V probably damaging Het
Mia T C 7: 26,880,403 (GRCm39) D24G probably benign Het
Mon2 A T 10: 122,849,409 (GRCm39) L1297Q probably damaging Het
Musk T A 4: 58,373,171 (GRCm39) S691T possibly damaging Het
Myo5c A T 9: 75,203,294 (GRCm39) E1463D possibly damaging Het
Ndufs6 C T 13: 73,468,438 (GRCm39) G87D probably damaging Het
Npnt C T 3: 132,610,479 (GRCm39) V415I probably benign Het
Ntsr2 A G 12: 16,706,769 (GRCm39) I266V probably benign Het
Or11j4 A T 14: 50,630,845 (GRCm39) I211F possibly damaging Het
Or5aq7 T C 2: 86,938,778 (GRCm39) probably benign Het
Pkmyt1 T A 17: 23,952,630 (GRCm39) probably null Het
Polr1e T C 4: 45,026,813 (GRCm39) L166P probably damaging Het
Ppib T G 9: 65,968,756 (GRCm39) F48C probably damaging Het
Ppl C A 16: 4,905,793 (GRCm39) E1501* probably null Het
Prpf8 T C 11: 75,382,321 (GRCm39) V384A probably benign Het
Ptch1 T G 13: 63,661,503 (GRCm39) S1212R probably damaging Het
Ralb C A 1: 119,403,735 (GRCm39) D131Y probably damaging Het
Rfx4 T A 10: 84,680,099 (GRCm39) M141K probably damaging Het
Rgl2 T A 17: 34,156,105 (GRCm39) probably null Het
Rpl27 A G 11: 101,334,782 (GRCm39) probably benign Het
Sdc1 A C 12: 8,841,297 (GRCm39) T213P probably damaging Het
Setx T A 2: 29,061,360 (GRCm39) N2256K possibly damaging Het
Shank2 A G 7: 143,585,034 (GRCm39) M12V probably benign Het
Slc22a28 T A 19: 8,049,253 (GRCm39) K332M probably damaging Het
Slf2 A T 19: 44,923,864 (GRCm39) H226L probably benign Het
Tbc1d10b T C 7: 126,802,584 (GRCm39) S362G probably benign Het
Tbxas1 G A 6: 38,929,046 (GRCm39) probably benign Het
Tctn1 A G 5: 122,399,575 (GRCm39) V83A probably damaging Het
Tgm4 A G 9: 122,885,583 (GRCm39) E375G probably damaging Het
Tmeff2 T A 1: 51,172,273 (GRCm39) Y247* probably null Het
Tmem167b C T 3: 108,466,211 (GRCm39) R79H possibly damaging Het
Tmprss7 T G 16: 45,489,936 (GRCm39) M429L probably benign Het
Tnfsf18 T A 1: 161,331,148 (GRCm39) D99E probably benign Het
Tnrc18 A T 5: 142,713,736 (GRCm39) S2534T probably damaging Het
Tnxb A G 17: 34,897,968 (GRCm39) E872G probably damaging Het
Tomm40l C T 1: 171,047,206 (GRCm39) V237I possibly damaging Het
Trbv2 A G 6: 41,024,836 (GRCm39) Q84R probably benign Het
Tspan18 T C 2: 93,040,219 (GRCm39) R179G probably benign Het
Tspan8 G T 10: 115,669,132 (GRCm39) V56L probably benign Het
Zbtb22 T C 17: 34,137,711 (GRCm39) S619P probably damaging Het
Zfp2 A T 11: 50,791,428 (GRCm39) I205N probably damaging Het
Zfpm1 A G 8: 123,063,850 (GRCm39) probably benign Het
Other mutations in Hsd3b7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Hsd3b7 APN 7 127,402,144 (GRCm39) missense probably damaging 1.00
IGL01589:Hsd3b7 APN 7 127,402,036 (GRCm39) missense probably damaging 1.00
IGL03037:Hsd3b7 APN 7 127,400,322 (GRCm39) missense probably damaging 1.00
irritated UTSW 7 127,400,306 (GRCm39) nonsense probably null
R0518:Hsd3b7 UTSW 7 127,402,251 (GRCm39) missense probably benign 0.01
R1801:Hsd3b7 UTSW 7 127,402,206 (GRCm39) missense possibly damaging 0.82
R2860:Hsd3b7 UTSW 7 127,401,442 (GRCm39) missense probably damaging 1.00
R2861:Hsd3b7 UTSW 7 127,401,442 (GRCm39) missense probably damaging 1.00
R4059:Hsd3b7 UTSW 7 127,400,717 (GRCm39) missense probably damaging 1.00
R5129:Hsd3b7 UTSW 7 127,400,306 (GRCm39) nonsense probably null
R5497:Hsd3b7 UTSW 7 127,401,060 (GRCm39) missense probably damaging 1.00
R6143:Hsd3b7 UTSW 7 127,400,404 (GRCm39) missense probably damaging 1.00
R6984:Hsd3b7 UTSW 7 127,400,717 (GRCm39) missense probably damaging 1.00
R7067:Hsd3b7 UTSW 7 127,399,888 (GRCm39) critical splice donor site probably null
R7910:Hsd3b7 UTSW 7 127,400,419 (GRCm39) critical splice donor site probably null
R8172:Hsd3b7 UTSW 7 127,401,546 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTTGTTCTCCACCAGACAGAGG -3'
(R):5'- ATCAGGTCAGGACAGGGTTC -3'

Sequencing Primer
(F):5'- ACCAGACAGAGGGGCCG -3'
(R):5'- TCAGGACAGGGTTCGACAGC -3'
Posted On 2018-04-27