Mutagenetix > Incidental Mutation

Incidental Mutation 'R6358:Shank2'

513339

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

044508-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6358 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143555665-143978231 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143585034 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 12 (M12V)

Ref Sequence

ENSEMBL: ENSMUSP00000149134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105902] [ENSMUST00000213146]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000105902
AA Change: M12V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: M12V

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213146
AA Change: M12V

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam39	T	C	8: 41,279,718 (GRCm39)	V703A	probably benign	Het
Adgrv1	T	A	13: 81,562,702 (GRCm39)	Q5389L	probably damaging	Het
Aldh18a1	A	T	19: 40,566,122 (GRCm39)	I42N	possibly damaging	Het
Ankrd28	A	C	14: 31,432,821 (GRCm39)	C575W	probably damaging	Het
Car14	T	A	3: 95,805,487 (GRCm39)	T329S	possibly damaging	Het
Cdhr2	T	C	13: 54,884,359 (GRCm39)	F1298S	probably damaging	Het
Crhr2	A	G	6: 55,070,028 (GRCm39)	I341T	probably benign	Het
D5Ertd579e	T	A	5: 36,773,580 (GRCm39)		probably null	Het
Eif1ad3	A	G	12: 87,843,770 (GRCm39)	E139G	unknown	Het
Emilin1	A	G	5: 31,075,562 (GRCm39)	E601G	probably damaging	Het
Erbin	T	A	13: 103,982,073 (GRCm39)	Q456L	probably damaging	Het
Glp1r	T	C	17: 31,151,618 (GRCm39)	V405A	probably benign	Het
Gm10220	C	G	5: 26,325,303 (GRCm39)		probably null	Het
Gm527	A	T	12: 64,970,322 (GRCm39)	H219L	possibly damaging	Het
Gorasp2	T	A	2: 70,503,104 (GRCm39)	M1K	probably null	Het
H2-DMa	T	A	17: 34,356,958 (GRCm39)	L152H	probably damaging	Het
Hsd3b7	T	A	7: 127,400,709 (GRCm39)	H54Q	probably damaging	Het
Hspa12b	T	C	2: 130,978,986 (GRCm39)		probably benign	Het
Iars1	C	A	13: 49,880,619 (GRCm39)	T1006K	possibly damaging	Het
Jmjd1c	T	C	10: 67,061,718 (GRCm39)	V1357A	probably benign	Het
Magi3	T	C	3: 103,958,268 (GRCm39)	M606V	probably damaging	Het
Mia	T	C	7: 26,880,403 (GRCm39)	D24G	probably benign	Het
Mon2	A	T	10: 122,849,409 (GRCm39)	L1297Q	probably damaging	Het
Musk	T	A	4: 58,373,171 (GRCm39)	S691T	possibly damaging	Het
Myo5c	A	T	9: 75,203,294 (GRCm39)	E1463D	possibly damaging	Het
Ndufs6	C	T	13: 73,468,438 (GRCm39)	G87D	probably damaging	Het
Npnt	C	T	3: 132,610,479 (GRCm39)	V415I	probably benign	Het
Ntsr2	A	G	12: 16,706,769 (GRCm39)	I266V	probably benign	Het
Or11j4	A	T	14: 50,630,845 (GRCm39)	I211F	possibly damaging	Het
Or5aq7	T	C	2: 86,938,778 (GRCm39)		probably benign	Het
Pkmyt1	T	A	17: 23,952,630 (GRCm39)		probably null	Het
Polr1e	T	C	4: 45,026,813 (GRCm39)	L166P	probably damaging	Het
Ppib	T	G	9: 65,968,756 (GRCm39)	F48C	probably damaging	Het
Ppl	C	A	16: 4,905,793 (GRCm39)	E1501*	probably null	Het
Prpf8	T	C	11: 75,382,321 (GRCm39)	V384A	probably benign	Het
Ptch1	T	G	13: 63,661,503 (GRCm39)	S1212R	probably damaging	Het
Ralb	C	A	1: 119,403,735 (GRCm39)	D131Y	probably damaging	Het
Rfx4	T	A	10: 84,680,099 (GRCm39)	M141K	probably damaging	Het
Rgl2	T	A	17: 34,156,105 (GRCm39)		probably null	Het
Rpl27	A	G	11: 101,334,782 (GRCm39)		probably benign	Het
Sdc1	A	C	12: 8,841,297 (GRCm39)	T213P	probably damaging	Het
Setx	T	A	2: 29,061,360 (GRCm39)	N2256K	possibly damaging	Het
Slc22a28	T	A	19: 8,049,253 (GRCm39)	K332M	probably damaging	Het
Slf2	A	T	19: 44,923,864 (GRCm39)	H226L	probably benign	Het
Tbc1d10b	T	C	7: 126,802,584 (GRCm39)	S362G	probably benign	Het
Tbxas1	G	A	6: 38,929,046 (GRCm39)		probably benign	Het
Tctn1	A	G	5: 122,399,575 (GRCm39)	V83A	probably damaging	Het
Tgm4	A	G	9: 122,885,583 (GRCm39)	E375G	probably damaging	Het
Tmeff2	T	A	1: 51,172,273 (GRCm39)	Y247*	probably null	Het
Tmem167b	C	T	3: 108,466,211 (GRCm39)	R79H	possibly damaging	Het
Tmprss7	T	G	16: 45,489,936 (GRCm39)	M429L	probably benign	Het
Tnfsf18	T	A	1: 161,331,148 (GRCm39)	D99E	probably benign	Het
Tnrc18	A	T	5: 142,713,736 (GRCm39)	S2534T	probably damaging	Het
Tnxb	A	G	17: 34,897,968 (GRCm39)	E872G	probably damaging	Het
Tomm40l	C	T	1: 171,047,206 (GRCm39)	V237I	possibly damaging	Het
Trbv2	A	G	6: 41,024,836 (GRCm39)	Q84R	probably benign	Het
Tspan18	T	C	2: 93,040,219 (GRCm39)	R179G	probably benign	Het
Tspan8	G	T	10: 115,669,132 (GRCm39)	V56L	probably benign	Het
Zbtb22	T	C	17: 34,137,711 (GRCm39)	S619P	probably damaging	Het
Zfp2	A	T	11: 50,791,428 (GRCm39)	I205N	probably damaging	Het
Zfpm1	A	G	8: 123,063,850 (GRCm39)		probably benign	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	143,965,584 (GRCm39)	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	143,964,512 (GRCm39)	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	143,965,008 (GRCm39)	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	143,838,805 (GRCm39)	nonsense	probably null
IGL01996:Shank2	APN	7	143,965,230 (GRCm39)	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	143,838,784 (GRCm39)	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	143,965,008 (GRCm39)	missense	probably benign	0.01
IGL02320:Shank2	APN	7	143,974,681 (GRCm39)	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	143,963,373 (GRCm39)	missense	probably benign	0.03
IGL02997:Shank2	APN	7	143,635,610 (GRCm39)	missense	probably benign	0.16
R0077:Shank2	UTSW	7	143,746,204 (GRCm39)	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	143,964,314 (GRCm39)	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	143,585,092 (GRCm39)	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	143,623,872 (GRCm39)	missense	probably benign	0.04
R0644:Shank2	UTSW	7	143,965,586 (GRCm39)	missense	probably benign
R1072:Shank2	UTSW	7	143,965,305 (GRCm39)	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	143,965,457 (GRCm39)	missense	probably benign	0.00
R1424:Shank2	UTSW	7	143,606,109 (GRCm39)	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	143,964,890 (GRCm39)	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	143,733,590 (GRCm39)	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	143,964,336 (GRCm39)	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	143,740,595 (GRCm39)	nonsense	probably null
R2074:Shank2	UTSW	7	143,963,277 (GRCm39)	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	143,964,971 (GRCm39)	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	143,611,455 (GRCm39)	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	143,965,314 (GRCm39)	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	143,606,042 (GRCm39)	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	143,622,507 (GRCm39)	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	143,623,792 (GRCm39)	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	143,635,611 (GRCm39)	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	143,959,121 (GRCm39)	missense	probably benign
R3907:Shank2	UTSW	7	143,963,313 (GRCm39)	missense	probably damaging	1.00
R3938:Shank2	UTSW	7	143,682,112 (GRCm39)	missense	probably benign	0.20
R4151:Shank2	UTSW	7	143,608,565 (GRCm39)	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	143,733,518 (GRCm39)	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	143,964,599 (GRCm39)	missense	probably benign	0.09
R4519:Shank2	UTSW	7	143,963,942 (GRCm39)	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	143,965,161 (GRCm39)	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	143,964,159 (GRCm39)	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	143,965,566 (GRCm39)	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	143,974,342 (GRCm39)	missense	probably benign	0.07
R4751:Shank2	UTSW	7	143,963,205 (GRCm39)	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	143,606,043 (GRCm39)	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	143,585,146 (GRCm39)	missense	probably benign	0.17
R4929:Shank2	UTSW	7	143,965,008 (GRCm39)	missense	probably benign	0.01
R5009:Shank2	UTSW	7	143,623,916 (GRCm39)	missense	probably benign	0.00
R5027:Shank2	UTSW	7	143,812,842 (GRCm39)	nonsense	probably null
R5165:Shank2	UTSW	7	143,963,373 (GRCm39)	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	143,622,612 (GRCm39)	critical splice donor site	probably null
R5332:Shank2	UTSW	7	143,965,029 (GRCm39)	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	143,963,271 (GRCm39)	missense	probably damaging	1.00
R5525:Shank2	UTSW	7	143,623,846 (GRCm39)	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	143,963,871 (GRCm39)	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	143,960,960 (GRCm39)	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	143,733,768 (GRCm39)	missense	probably benign	0.12
R6306:Shank2	UTSW	7	143,963,417 (GRCm39)	missense	probably benign	0.00
R6317:Shank2	UTSW	7	143,838,821 (GRCm39)	missense	possibly damaging	0.89
R6364:Shank2	UTSW	7	143,964,146 (GRCm39)	missense	probably benign	0.14
R6413:Shank2	UTSW	7	143,963,955 (GRCm39)	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	143,974,603 (GRCm39)	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	143,963,631 (GRCm39)	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	143,606,197 (GRCm39)	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	143,645,515 (GRCm39)	missense	probably benign	0.19
R6983:Shank2	UTSW	7	143,635,585 (GRCm39)	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	143,964,096 (GRCm39)	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	143,964,901 (GRCm39)	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	143,965,289 (GRCm39)	missense	probably benign	0.00
R7213:Shank2	UTSW	7	143,585,146 (GRCm39)	missense	probably benign	0.17
R7225:Shank2	UTSW	7	143,838,762 (GRCm39)	missense	probably benign	0.42
R7325:Shank2	UTSW	7	143,965,422 (GRCm39)	missense	probably benign	0.04
R7605:Shank2	UTSW	7	143,645,516 (GRCm39)	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	143,965,131 (GRCm39)	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	143,964,798 (GRCm39)	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	143,963,612 (GRCm39)	missense	probably benign	0.01
R8722:Shank2	UTSW	7	143,729,485 (GRCm39)	intron	probably benign
R8866:Shank2	UTSW	7	143,964,986 (GRCm39)	missense	probably benign
R8919:Shank2	UTSW	7	143,965,265 (GRCm39)	missense	probably damaging	1.00
R8944:Shank2	UTSW	7	143,623,927 (GRCm39)	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	143,965,236 (GRCm39)	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	143,963,705 (GRCm39)	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	143,622,535 (GRCm39)	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	143,963,705 (GRCm39)	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	143,960,945 (GRCm39)	missense	probably benign	0.00
R9362:Shank2	UTSW	7	143,963,271 (GRCm39)	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	143,964,752 (GRCm39)	missense	possibly damaging	0.77
R9524:Shank2	UTSW	7	143,964,183 (GRCm39)	missense	possibly damaging	0.71
R9557:Shank2	UTSW	7	143,963,847 (GRCm39)	missense	probably benign	0.00
R9559:Shank2	UTSW	7	143,585,041 (GRCm39)	missense	probably benign	0.30
R9574:Shank2	UTSW	7	143,622,462 (GRCm39)	missense	possibly damaging	0.90
R9680:Shank2	UTSW	7	143,964,837 (GRCm39)	missense	probably damaging	0.96
R9720:Shank2	UTSW	7	143,682,137 (GRCm39)	missense	probably damaging	0.99
RF009:Shank2	UTSW	7	143,965,308 (GRCm39)	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	143,682,114 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGATCTGACATGCAAACACG -3'
(R):5'- TATGATCGGGTGTGGAAGCAC -3'

Sequencing Primer
(F):5'- TGCAAACACGTGGATGCC -3'
(R):5'- TGTATGCAGGAGCTCGCTCAC -3'

Posted On

2018-04-27