Mutagenetix > Incidental Mutation

Incidental Mutation 'R6358:Shank2'

513339

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6358 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144001928-144424494 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 144031297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 12 (M12V)

Ref Sequence

ENSEMBL: ENSMUSP00000149134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105902] [ENSMUST00000213146]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000105902
AA Change: M12V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: M12V

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213146
AA Change: M12V

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam39	T	C	8: 40,826,681	V703A	probably benign	Het
Adgrv1	T	A	13: 81,414,583	Q5389L	probably damaging	Het
Aldh18a1	A	T	19: 40,577,678	I42N	possibly damaging	Het
Ankrd28	A	C	14: 31,710,864	C575W	probably damaging	Het
Car14	T	A	3: 95,898,175	T329S	possibly damaging	Het
Cdhr2	T	C	13: 54,736,546	F1298S	probably damaging	Het
Crhr2	A	G	6: 55,093,043	I341T	probably benign	Het
D5Ertd579e	T	A	5: 36,616,236		probably null	Het
Emilin1	A	G	5: 30,918,218	E601G	probably damaging	Het
Erbin	T	A	13: 103,845,565	Q456L	probably damaging	Het
Glp1r	T	C	17: 30,932,644	V405A	probably benign	Het
Gm10220	C	G	5: 26,120,305		probably null	Het
Gm2016	A	G	12: 87,877,000	E139G	unknown	Het
Gm527	A	T	12: 64,923,548	H219L	possibly damaging	Het
Gorasp2	T	A	2: 70,672,760	M1K	probably null	Het
H2-DMa	T	A	17: 34,137,984	L152H	probably damaging	Het
Hsd3b7	T	A	7: 127,801,537	H54Q	probably damaging	Het
Hspa12b	T	C	2: 131,137,066		probably benign	Het
Iars	C	A	13: 49,727,143	T1006K	possibly damaging	Het
Jmjd1c	T	C	10: 67,225,939	V1357A	probably benign	Het
Magi3	T	C	3: 104,050,952	M606V	probably damaging	Het
Mia	T	C	7: 27,180,978	D24G	probably benign	Het
Mon2	A	T	10: 123,013,504	L1297Q	probably damaging	Het
Musk	T	A	4: 58,373,171	S691T	possibly damaging	Het
Myo5c	A	T	9: 75,296,012	E1463D	possibly damaging	Het
Ndufs6	C	T	13: 73,320,319	G87D	probably damaging	Het
Npnt	C	T	3: 132,904,718	V415I	probably benign	Het
Ntsr2	A	G	12: 16,656,768	I266V	probably benign	Het
Olfr259	T	C	2: 87,108,434		probably benign	Het
Olfr736	A	T	14: 50,393,388	I211F	possibly damaging	Het
Pkmyt1	T	A	17: 23,733,656		probably null	Het
Polr1e	T	C	4: 45,026,813	L166P	probably damaging	Het
Ppib	T	G	9: 66,061,474	F48C	probably damaging	Het
Ppl	C	A	16: 5,087,929	E1501*	probably null	Het
Prpf8	T	C	11: 75,491,495	V384A	probably benign	Het
Ptch1	T	G	13: 63,513,689	S1212R	probably damaging	Het
Ralb	C	A	1: 119,476,005	D131Y	probably damaging	Het
Rfx4	T	A	10: 84,844,235	M141K	probably damaging	Het
Rgl2	T	A	17: 33,937,131		probably null	Het
Rpl27	A	G	11: 101,443,956		probably benign	Het
Sdc1	A	C	12: 8,791,297	T213P	probably damaging	Het
Setx	T	A	2: 29,171,348	N2256K	possibly damaging	Het
Slc22a28	T	A	19: 8,071,888	K332M	probably damaging	Het
Slf2	A	T	19: 44,935,425	H226L	probably benign	Het
Tbc1d10b	T	C	7: 127,203,412	S362G	probably benign	Het
Tbxas1	G	A	6: 38,952,112		probably benign	Het
Tctn1	A	G	5: 122,261,512	V83A	probably damaging	Het
Tgm4	A	G	9: 123,056,518	E375G	probably damaging	Het
Tmeff2	T	A	1: 51,133,114	Y247*	probably null	Het
Tmem167b	C	T	3: 108,558,895	R79H	possibly damaging	Het
Tmprss7	T	G	16: 45,669,573	M429L	probably benign	Het
Tnfsf18	T	A	1: 161,503,579	D99E	probably benign	Het
Tnrc18	A	T	5: 142,727,981	S2534T	probably damaging	Het
Tnxb	A	G	17: 34,678,994	E872G	probably damaging	Het
Tomm40l	C	T	1: 171,219,637	V237I	possibly damaging	Het
Trbv2	A	G	6: 41,047,902	Q84R	probably benign	Het
Tspan18	T	C	2: 93,209,874	R179G	probably benign	Het
Tspan8	G	T	10: 115,833,227	V56L	probably benign	Het
Zbtb22	T	C	17: 33,918,737	S619P	probably damaging	Het
Zfp2	A	T	11: 50,900,601	I205N	probably damaging	Het
Zfpm1	A	G	8: 122,337,111		probably benign	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	144411847	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	144410775	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	144411271	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	144285068	nonsense	probably null
IGL01996:Shank2	APN	7	144411493	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	144285047	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	144411271	missense	probably benign	0.01
IGL02320:Shank2	APN	7	144420944	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	144409636	missense	probably benign	0.03
IGL02997:Shank2	APN	7	144081873	missense	probably benign	0.16
R0077:Shank2	UTSW	7	144192467	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	144410577	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	144031355	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	144070135	missense	probably benign	0.04
R0644:Shank2	UTSW	7	144411849	missense	probably benign
R1072:Shank2	UTSW	7	144411568	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	144411720	missense	probably benign	0.00
R1424:Shank2	UTSW	7	144052372	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	144411153	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	144179853	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	144410599	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	144186858	nonsense	probably null
R2074:Shank2	UTSW	7	144409540	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	144411234	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	144057718	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	144411577	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	144052305	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	144068770	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	144070055	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	144081874	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	144405384	missense	probably benign
R3907:Shank2	UTSW	7	144409576	missense	probably damaging	1.00
R3938:Shank2	UTSW	7	144128375	missense	probably benign	0.20
R4151:Shank2	UTSW	7	144054828	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	144179781	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	144410862	missense	probably benign	0.09
R4519:Shank2	UTSW	7	144410205	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	144411424	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	144410422	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	144411829	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	144420605	missense	probably benign	0.07
R4751:Shank2	UTSW	7	144409468	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	144052306	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R4929:Shank2	UTSW	7	144411271	missense	probably benign	0.01
R5009:Shank2	UTSW	7	144070179	missense	probably benign	0.00
R5027:Shank2	UTSW	7	144259105	nonsense	probably null
R5165:Shank2	UTSW	7	144409636	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	144068875	critical splice donor site	probably null
R5332:Shank2	UTSW	7	144411292	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R5525:Shank2	UTSW	7	144070109	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	144410134	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	144407223	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	144180031	missense	probably benign	0.12
R6306:Shank2	UTSW	7	144409680	missense	probably benign	0.00
R6317:Shank2	UTSW	7	144285084	missense	possibly damaging	0.89
R6364:Shank2	UTSW	7	144410409	missense	probably benign	0.14
R6413:Shank2	UTSW	7	144410218	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	144420866	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	144409894	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	144052460	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	144091778	missense	probably benign	0.19
R6983:Shank2	UTSW	7	144081848	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	144410359	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	144411164	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	144411552	missense	probably benign	0.00
R7213:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R7225:Shank2	UTSW	7	144285025	missense	probably benign	0.42
R7325:Shank2	UTSW	7	144411685	missense	probably benign	0.04
R7605:Shank2	UTSW	7	144091779	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	144411394	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	144411061	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	144409875	missense	probably benign	0.01
R8722:Shank2	UTSW	7	144175748	intron	probably benign
R8866:Shank2	UTSW	7	144411249	missense	probably benign
R8919:Shank2	UTSW	7	144411528	missense	probably damaging	1.00
R8944:Shank2	UTSW	7	144070190	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	144411499	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	144068798	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	144407208	missense	probably benign	0.00
R9362:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	144411015	missense	possibly damaging	0.77
R9524:Shank2	UTSW	7	144410446	missense	possibly damaging	0.71
R9557:Shank2	UTSW	7	144410110	missense	probably benign	0.00
R9559:Shank2	UTSW	7	144031304	missense	probably benign	0.30
R9574:Shank2	UTSW	7	144068725	missense	possibly damaging	0.90
R9680:Shank2	UTSW	7	144411100	missense	probably damaging	0.96
R9720:Shank2	UTSW	7	144128400	missense	probably damaging	0.99
RF009:Shank2	UTSW	7	144411571	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	144128377	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGATCTGACATGCAAACACG -3'
(R):5'- TATGATCGGGTGTGGAAGCAC -3'

Sequencing Primer
(F):5'- TGCAAACACGTGGATGCC -3'
(R):5'- TGTATGCAGGAGCTCGCTCAC -3'

Posted On

2018-04-27