Incidental Mutation 'R6358:Rfx4'
ID513346
Institutional Source Beutler Lab
Gene Symbol Rfx4
Ensembl Gene ENSMUSG00000020037
Gene Nameregulatory factor X, 4 (influences HLA class II expression)
Synonyms4933412G19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location84756062-84906538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84844235 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 141 (M141K)
Ref Sequence ENSEMBL: ENSMUSP00000093035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060397] [ENSMUST00000095388] [ENSMUST00000166696]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000020226
Predicted Effect probably damaging
Transcript: ENSMUST00000060397
AA Change: M235K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051107
Gene: ENSMUSG00000020037
AA Change: M235K

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 58 136 7.9e-37 PFAM
Blast:HisKA 293 356 5e-7 BLAST
low complexity region 503 515 N/A INTRINSIC
low complexity region 521 537 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095388
AA Change: M141K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093035
Gene: ENSMUSG00000020037
AA Change: M141K

DomainStartEndE-ValueType
SCOP:d1kwha_ 11 201 6e-3 SMART
Blast:HisKA 199 262 4e-7 BLAST
low complexity region 409 421 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
low complexity region 505 517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166696
AA Change: M92K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128690
Gene: ENSMUSG00000020037
AA Change: M92K

DomainStartEndE-ValueType
Blast:HisKA 150 213 6e-7 BLAST
low complexity region 360 372 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
low complexity region 456 468 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Inactivating null allele or homozygous point mutation alleles exhibit missing dorsal midline structure of the cortex including the subcommissural organ and neonatal lethality. Heterozygous null mice have congenital hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Rfx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Rfx4 APN 10 84840199 missense probably damaging 1.00
IGL00334:Rfx4 APN 10 84780053 missense possibly damaging 0.91
IGL00928:Rfx4 APN 10 84840114 missense probably benign 0.04
IGL01063:Rfx4 APN 10 84868382 missense possibly damaging 0.90
IGL01490:Rfx4 APN 10 84840851 missense possibly damaging 0.85
IGL02390:Rfx4 APN 10 84840150 missense probably damaging 1.00
IGL02454:Rfx4 APN 10 84840106 missense possibly damaging 0.83
R0099:Rfx4 UTSW 10 84894304 missense probably benign
R0503:Rfx4 UTSW 10 84894332 missense possibly damaging 0.56
R0924:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R0930:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R1386:Rfx4 UTSW 10 84863285 missense probably damaging 1.00
R1715:Rfx4 UTSW 10 84844280 missense probably damaging 1.00
R1738:Rfx4 UTSW 10 84880975 critical splice donor site probably null
R1987:Rfx4 UTSW 10 84896088 missense possibly damaging 0.87
R3717:Rfx4 UTSW 10 84880224 missense probably damaging 1.00
R4231:Rfx4 UTSW 10 84814694 missense probably benign 0.03
R4300:Rfx4 UTSW 10 84905102 missense probably damaging 0.98
R4581:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4582:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4618:Rfx4 UTSW 10 84880896 missense probably benign 0.01
R5156:Rfx4 UTSW 10 84868354 missense probably damaging 1.00
R5185:Rfx4 UTSW 10 84863250 missense probably damaging 1.00
R5377:Rfx4 UTSW 10 84860542 missense possibly damaging 0.81
R5601:Rfx4 UTSW 10 84798578 missense probably damaging 1.00
R5879:Rfx4 UTSW 10 84814761 critical splice donor site probably null
R5996:Rfx4 UTSW 10 84840017 nonsense probably null
R6805:Rfx4 UTSW 10 84840228 missense possibly damaging 0.86
R7248:Rfx4 UTSW 10 84905055 missense probably benign 0.05
R7427:Rfx4 UTSW 10 84896012 missense probably benign 0.28
R7428:Rfx4 UTSW 10 84896012 missense probably benign 0.28
R7514:Rfx4 UTSW 10 84880226 missense probably damaging 1.00
R7576:Rfx4 UTSW 10 84863349 missense probably damaging 0.98
R8002:Rfx4 UTSW 10 84840857 missense probably damaging 0.97
RF005:Rfx4 UTSW 10 84858494 critical splice acceptor site probably benign
RF010:Rfx4 UTSW 10 84858487 critical splice acceptor site probably benign
RF014:Rfx4 UTSW 10 84858489 critical splice acceptor site probably benign
RF015:Rfx4 UTSW 10 84858489 critical splice acceptor site probably benign
RF023:Rfx4 UTSW 10 84858485 critical splice acceptor site probably benign
RF030:Rfx4 UTSW 10 84858480 critical splice acceptor site probably benign
RF035:Rfx4 UTSW 10 84858480 critical splice acceptor site probably benign
RF046:Rfx4 UTSW 10 84858481 critical splice acceptor site probably benign
RF060:Rfx4 UTSW 10 84858494 critical splice acceptor site probably benign
RF062:Rfx4 UTSW 10 84858481 critical splice acceptor site probably benign
X0024:Rfx4 UTSW 10 84780074 missense possibly damaging 0.82
Z1177:Rfx4 UTSW 10 84814684 missense possibly damaging 0.85
Z1177:Rfx4 UTSW 10 84896091 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCAAAACCTGTCCAGTCCTC -3'
(R):5'- ATCAAGTACTAGCCGATGCC -3'

Sequencing Primer
(F):5'- TGGGCACAAGTCCCACAG -3'
(R):5'- TACTAGCCGATGCCTGGGC -3'
Posted On2018-04-27