Incidental Mutation 'R6358:Tspan8'
ID513347
Institutional Source Beutler Lab
Gene Symbol Tspan8
Ensembl Gene ENSMUSG00000034127
Gene Nametetraspanin 8
SynonymsTm4sf3, E330007O21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location115816832-115849893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115833227 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 56 (V56L)
Ref Sequence ENSEMBL: ENSMUSP00000136645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035563] [ENSMUST00000080630] [ENSMUST00000179196] [ENSMUST00000217900]
Predicted Effect probably benign
Transcript: ENSMUST00000035563
AA Change: V56L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049243
Gene: ENSMUSG00000034127
AA Change: V56L

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 4.8e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080630
AA Change: V56L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000079463
Gene: ENSMUSG00000034127
AA Change: V56L

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 8.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179196
AA Change: V56L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136645
Gene: ENSMUSG00000034127
AA Change: V56L

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 232 8.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217900
AA Change: V56L

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220081
Meta Mutation Damage Score 0.3567 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This gene is expressed in different carcinomas. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Tspan8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Tspan8 APN 10 115844139 splice site probably benign
IGL01738:Tspan8 APN 10 115817665 splice site probably null
IGL01755:Tspan8 APN 10 115835298 missense probably damaging 1.00
IGL01993:Tspan8 APN 10 115840008 splice site probably benign
IGL02369:Tspan8 APN 10 115839877 missense probably benign 0.01
IGL02369:Tspan8 APN 10 115839878 missense probably benign 0.44
PIT4131001:Tspan8 UTSW 10 115817610 missense probably damaging 1.00
R1269:Tspan8 UTSW 10 115849382 missense probably damaging 0.97
R1693:Tspan8 UTSW 10 115844044 splice site probably benign
R1850:Tspan8 UTSW 10 115833225 missense probably damaging 0.98
R1975:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R1976:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R1977:Tspan8 UTSW 10 115844130 missense probably benign 0.00
R4058:Tspan8 UTSW 10 115835282 nonsense probably null
R4059:Tspan8 UTSW 10 115835282 nonsense probably null
R4999:Tspan8 UTSW 10 115817629 missense possibly damaging 0.91
R5879:Tspan8 UTSW 10 115833251 missense possibly damaging 0.89
R6290:Tspan8 UTSW 10 115827824 missense probably damaging 0.98
R6524:Tspan8 UTSW 10 115844079 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAGGACAATTCAAGGCTGGAAAC -3'
(R):5'- CATTAAGCTTGGCAAGGACAAG -3'

Sequencing Primer
(F):5'- TCAGGAGGTGCCAACATTTC -3'
(R):5'- CTTGGCAAGGACAAGTCTTGTGAC -3'
Posted On2018-04-27