Incidental Mutation 'R6358:Sdc1'
ID513352
Institutional Source Beutler Lab
Gene Symbol Sdc1
Ensembl Gene ENSMUSG00000020592
Gene Namesyndecan 1
SynonymsSynd1, syn-1, CD138, Synd
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R6358 (G1)
Quality Score139.008
Status Validated
Chromosome12
Chromosomal Location8771323-8793715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 8791297 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 213 (T213P)
Ref Sequence ENSEMBL: ENSMUSP00000131491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020911] [ENSMUST00000161883] [ENSMUST00000171158]
Predicted Effect probably damaging
Transcript: ENSMUST00000020911
AA Change: T213P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020911
Gene: ENSMUSG00000020592
AA Change: T213P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 33 50 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
4.1m 276 294 5.47e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160348
Predicted Effect probably benign
Transcript: ENSMUST00000161883
SMART Domains Protein: ENSMUSP00000123896
Gene: ENSMUSG00000020592

DomainStartEndE-ValueType
low complexity region 37 54 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
low complexity region 141 156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171158
AA Change: T213P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131491
Gene: ENSMUSG00000020592
AA Change: T213P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 33 50 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
4.1m 276 294 5.47e-6 SMART
Meta Mutation Damage Score 0.1384 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane (type I) heparan sulfate proteoglycan and is a member of the syndecan proteoglycan family. The syndecans mediate cell binding, cell signaling, and cytoskeletal organization and syndecan receptors are required for internalization of the HIV-1 tat protein. The syndecan-1 protein functions as an integral membrane protein and participates in cell proliferation, cell migration and cell-matrix interactions via its receptor for extracellular matrix proteins. Altered syndecan-1 expression has been detected in several different tumor types. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutant mice are overtly normal but resist mammary tumor development in response to Wnt1, and show delayed cutaneous and corneal wound healing, defective leukocyte adhesion to endothelia, increased angiogenesis, as well as reduced susceptibility to P. aeruginosa lung infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Sdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Sdc1 APN 12 8790459 missense possibly damaging 0.75
IGL02197:Sdc1 APN 12 8790835 missense possibly damaging 0.90
E0374:Sdc1 UTSW 12 8789424 missense probably damaging 1.00
R1673:Sdc1 UTSW 12 8790409 missense possibly damaging 0.66
R4700:Sdc1 UTSW 12 8790541 missense possibly damaging 0.82
R4887:Sdc1 UTSW 12 8791708 missense probably damaging 1.00
R5396:Sdc1 UTSW 12 8791743 unclassified probably null
R7272:Sdc1 UTSW 12 8790554 missense probably benign 0.41
R7575:Sdc1 UTSW 12 8790619 missense probably damaging 1.00
R7741:Sdc1 UTSW 12 8791370 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TACGTTGTGTCACTGGAGGC -3'
(R):5'- TGCTGCTAAAGATGCTTCACCC -3'

Sequencing Primer
(F):5'- TGTCACTGGAGGCGGTATC -3'
(R):5'- GGCTACCTCAGAGCCACC -3'
Posted On2018-04-27