Incidental Mutation 'R6358:Ntsr2'
ID513353
Institutional Source Beutler Lab
Gene Symbol Ntsr2
Ensembl Gene ENSMUSG00000020591
Gene Nameneurotensin receptor 2
SynonymsNTRL, NT2R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location16653382-16660227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16656768 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 266 (I266V)
Ref Sequence ENSEMBL: ENSMUSP00000106693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111064] [ENSMUST00000220892] [ENSMUST00000221049] [ENSMUST00000221596]
Predicted Effect probably benign
Transcript: ENSMUST00000111064
AA Change: I266V

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106693
Gene: ENSMUSG00000020591
AA Change: I266V

DomainStartEndE-ValueType
Pfam:7tm_1 49 358 4.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220892
Predicted Effect probably benign
Transcript: ENSMUST00000221049
AA Change: I180V

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000221596
AA Change: I235V

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222957
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G protein-coupled receptor family that activate a phosphatidylinositol-calcium second messenger system. Binding and pharmacological studies demonstrate that this receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. However, unlike NT1 receptor, this gene recognizes, with high affinity, levocabastine, a histamine H1 receptor antagonist previously shown to compete with neurotensin for low-affinity binding sites in brain. These activities suggest that this receptor may be of physiological importance and that a natural agonist for the receptor may exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit abnormal thermal nociception. Mice homozygous for different knock-out allele exhibit increased prepulse inhibition and decreased accoustic startle response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Ntsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Ntsr2 APN 12 16659848 missense probably damaging 0.97
IGL01973:Ntsr2 APN 12 16656774 missense probably benign 0.01
IGL02202:Ntsr2 APN 12 16653660 missense probably damaging 0.99
IGL02493:Ntsr2 APN 12 16658389 missense possibly damaging 0.90
IGL02837:Ntsr2 UTSW 12 16653875 missense probably damaging 0.99
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0066:Ntsr2 UTSW 12 16654119 missense probably benign 0.09
R0381:Ntsr2 UTSW 12 16659718 nonsense probably null
R0437:Ntsr2 UTSW 12 16653695 missense probably damaging 1.00
R0666:Ntsr2 UTSW 12 16653980 missense probably benign 0.28
R0751:Ntsr2 UTSW 12 16654030 missense probably damaging 1.00
R1919:Ntsr2 UTSW 12 16654110 missense probably damaging 0.96
R2190:Ntsr2 UTSW 12 16654017 missense probably damaging 1.00
R5323:Ntsr2 UTSW 12 16659933 missense probably benign 0.00
R5358:Ntsr2 UTSW 12 16654082 missense probably damaging 1.00
R6282:Ntsr2 UTSW 12 16658425 missense probably damaging 1.00
R6523:Ntsr2 UTSW 12 16656696 missense probably benign 0.05
R6837:Ntsr2 UTSW 12 16659709 missense probably benign 0.04
R8396:Ntsr2 UTSW 12 16656820 missense probably damaging 1.00
RF017:Ntsr2 UTSW 12 16659765 missense probably damaging 0.99
X0064:Ntsr2 UTSW 12 16656757 missense probably damaging 1.00
Z1177:Ntsr2 UTSW 12 16653662 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACCTGATGTCCAGAGCCATAGG -3'
(R):5'- AGGAACTGATGGACACAATCCC -3'

Sequencing Primer
(F):5'- ACTCGGCATTACCTTCACAG -3'
(R):5'- ACACAATCCCTGGTCCTGG -3'
Posted On2018-04-27