Mutagenetix > Incidental Mutation

Incidental Mutation 'R6358:Ptch1'

513358

Institutional Source

Beutler Lab

Gene Symbol

Ptch1

Ensembl Gene

ENSMUSG00000021466

Gene Name

patched 1

Synonyms

A230106A15Rik, Patched 1, Ptc1, Ptc

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6358 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63508328-63573598 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 63513689 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1212 (S1212R)

Ref Sequence

ENSEMBL: ENSMUSP00000021921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021921] [ENSMUST00000192155] [ENSMUST00000194663] [ENSMUST00000195258]

AlphaFold

Q61115

Predicted Effect

probably damaging
Transcript: ENSMUST00000021921
AA Change: S1212R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000021921
Gene: ENSMUSG00000021466
AA Change: S1212R

Domain	Start	End	E-Value	Type
low complexity region	4	30	N/A	INTRINSIC
Pfam:Patched	351	871	7.6e-47	PFAM
Pfam:Sterol-sensing	448	602	1.5e-45	PFAM
Pfam:Patched	952	1166	9.8e-33	PFAM
low complexity region	1180	1189	N/A	INTRINSIC
low complexity region	1204	1213	N/A	INTRINSIC
low complexity region	1281	1296	N/A	INTRINSIC
low complexity region	1355	1367	N/A	INTRINSIC
low complexity region	1369	1384	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192155
AA Change: S1075R

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141489
Gene: ENSMUSG00000021466
AA Change: S1075R

Domain	Start	End	E-Value	Type
Pfam:Patched	214	733	3.1e-44	PFAM
Pfam:Sterol-sensing	311	465	2.8e-46	PFAM
Pfam:Patched	814	1029	3.1e-30	PFAM
low complexity region	1043	1052	N/A	INTRINSIC
low complexity region	1067	1076	N/A	INTRINSIC
low complexity region	1144	1159	N/A	INTRINSIC
low complexity region	1218	1230	N/A	INTRINSIC
low complexity region	1232	1247	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194663

SMART Domains

Protein: ENSMUSP00000141766
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	298	569	4.7e-34	PFAM
Pfam:Sterol-sensing	396	550	7.9e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195258

SMART Domains

Protein: ENSMUSP00000141309
Gene: ENSMUSG00000021466

Domain	Start	End	E-Value	Type
Pfam:Patched	212	426	7.8e-28	PFAM
Pfam:Sterol-sensing	311	426	8e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222040

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the patched gene family. The encoded protein is the receptor for sonic hedgehog, a secreted molecule implicated in the formation of embryonic structures and in tumorigenesis, as well as the desert hedgehog and indian hedgehog proteins. This gene functions as a tumor suppressor. Mutations of this gene have been associated with basal cell nevus syndrome, esophageal squamous cell carcinoma, trichoepitheliomas, transitional cell carcinomas of the bladder, as well as holoprosencephaly. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences and biological validity cannot be determined currently. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die by day 10 with neural tube defects. Heterozygotes are large with excess cerebellar granule cell proliferation and sometimes, hindlimb defects and medulloblastomas. Hypomorphic and spontaneous mutants have reproductive defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam39	T	C	8: 40,826,681	V703A	probably benign	Het
Adgrv1	T	A	13: 81,414,583	Q5389L	probably damaging	Het
Aldh18a1	A	T	19: 40,577,678	I42N	possibly damaging	Het
Ankrd28	A	C	14: 31,710,864	C575W	probably damaging	Het
Car14	T	A	3: 95,898,175	T329S	possibly damaging	Het
Cdhr2	T	C	13: 54,736,546	F1298S	probably damaging	Het
Crhr2	A	G	6: 55,093,043	I341T	probably benign	Het
D5Ertd579e	T	A	5: 36,616,236		probably null	Het
Emilin1	A	G	5: 30,918,218	E601G	probably damaging	Het
Erbin	T	A	13: 103,845,565	Q456L	probably damaging	Het
Glp1r	T	C	17: 30,932,644	V405A	probably benign	Het
Gm10220	C	G	5: 26,120,305		probably null	Het
Gm2016	A	G	12: 87,877,000	E139G	unknown	Het
Gm527	A	T	12: 64,923,548	H219L	possibly damaging	Het
Gorasp2	T	A	2: 70,672,760	M1K	probably null	Het
H2-DMa	T	A	17: 34,137,984	L152H	probably damaging	Het
Hsd3b7	T	A	7: 127,801,537	H54Q	probably damaging	Het
Hspa12b	T	C	2: 131,137,066		probably benign	Het
Iars	C	A	13: 49,727,143	T1006K	possibly damaging	Het
Jmjd1c	T	C	10: 67,225,939	V1357A	probably benign	Het
Magi3	T	C	3: 104,050,952	M606V	probably damaging	Het
Mia	T	C	7: 27,180,978	D24G	probably benign	Het
Mon2	A	T	10: 123,013,504	L1297Q	probably damaging	Het
Musk	T	A	4: 58,373,171	S691T	possibly damaging	Het
Myo5c	A	T	9: 75,296,012	E1463D	possibly damaging	Het
Ndufs6	C	T	13: 73,320,319	G87D	probably damaging	Het
Npnt	C	T	3: 132,904,718	V415I	probably benign	Het
Ntsr2	A	G	12: 16,656,768	I266V	probably benign	Het
Olfr259	T	C	2: 87,108,434		probably benign	Het
Olfr736	A	T	14: 50,393,388	I211F	possibly damaging	Het
Pkmyt1	T	A	17: 23,733,656		probably null	Het
Polr1e	T	C	4: 45,026,813	L166P	probably damaging	Het
Ppib	T	G	9: 66,061,474	F48C	probably damaging	Het
Ppl	C	A	16: 5,087,929	E1501*	probably null	Het
Prpf8	T	C	11: 75,491,495	V384A	probably benign	Het
Ralb	C	A	1: 119,476,005	D131Y	probably damaging	Het
Rfx4	T	A	10: 84,844,235	M141K	probably damaging	Het
Rgl2	T	A	17: 33,937,131		probably null	Het
Rpl27	A	G	11: 101,443,956		probably benign	Het
Sdc1	A	C	12: 8,791,297	T213P	probably damaging	Het
Setx	T	A	2: 29,171,348	N2256K	possibly damaging	Het
Shank2	A	G	7: 144,031,297	M12V	probably benign	Het
Slc22a28	T	A	19: 8,071,888	K332M	probably damaging	Het
Slf2	A	T	19: 44,935,425	H226L	probably benign	Het
Tbc1d10b	T	C	7: 127,203,412	S362G	probably benign	Het
Tbxas1	G	A	6: 38,952,112		probably benign	Het
Tctn1	A	G	5: 122,261,512	V83A	probably damaging	Het
Tgm4	A	G	9: 123,056,518	E375G	probably damaging	Het
Tmeff2	T	A	1: 51,133,114	Y247*	probably null	Het
Tmem167b	C	T	3: 108,558,895	R79H	possibly damaging	Het
Tmprss7	T	G	16: 45,669,573	M429L	probably benign	Het
Tnfsf18	T	A	1: 161,503,579	D99E	probably benign	Het
Tnrc18	A	T	5: 142,727,981	S2534T	probably damaging	Het
Tnxb	A	G	17: 34,678,994	E872G	probably damaging	Het
Tomm40l	C	T	1: 171,219,637	V237I	possibly damaging	Het
Trbv2	A	G	6: 41,047,902	Q84R	probably benign	Het
Tspan18	T	C	2: 93,209,874	R179G	probably benign	Het
Tspan8	G	T	10: 115,833,227	V56L	probably benign	Het
Zbtb22	T	C	17: 33,918,737	S619P	probably damaging	Het
Zfp2	A	T	11: 50,900,601	I205N	probably damaging	Het
Zfpm1	A	G	8: 122,337,111		probably benign	Het

Other mutations in Ptch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Ptch1	APN	13	63527175	missense	probably benign	0.00
IGL01084:Ptch1	APN	13	63543637	missense	probably damaging	0.99
IGL01369:Ptch1	APN	13	63511681	missense	probably benign
IGL02260:Ptch1	APN	13	63565352	unclassified	probably benign
IGL02439:Ptch1	APN	13	63545096	missense	probably damaging	1.00
IGL02588:Ptch1	APN	13	63511918	missense	probably benign	0.13
IGL02797:Ptch1	APN	13	63533607	missense	probably benign
R0463:Ptch1	UTSW	13	63520307	missense	probably damaging	0.98
R0539:Ptch1	UTSW	13	63543480	splice site	probably benign
R0657:Ptch1	UTSW	13	63513751	missense	possibly damaging	0.90
R0971:Ptch1	UTSW	13	63539843	missense	probably benign	0.23
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1466:Ptch1	UTSW	13	63524969	missense	probably benign	0.02
R1539:Ptch1	UTSW	13	63541287	missense	probably benign	0.00
R1616:Ptch1	UTSW	13	63539842	missense	possibly damaging	0.96
R1883:Ptch1	UTSW	13	63512027	nonsense	probably null
R1985:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R1986:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2024:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2025:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2026:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2027:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2096:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2097:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2100:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2105:Ptch1	UTSW	13	63545245	missense	probably benign
R2165:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2166:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2167:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2168:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2226:Ptch1	UTSW	13	63513671	missense	probably damaging	1.00
R2437:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2504:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2507:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2696:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R2698:Ptch1	UTSW	13	63542224	missense	probably damaging	1.00
R2971:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3410:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3708:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3744:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3745:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3783:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3784:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3785:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3807:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R3950:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4013:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4015:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4016:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4017:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4035:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4083:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4084:Ptch1	UTSW	13	63524959	missense	probably benign	0.00
R4179:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4222:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4348:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4349:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4350:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4351:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4353:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4485:Ptch1	UTSW	13	63534329	missense	probably damaging	1.00
R4595:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R4625:Ptch1	UTSW	13	63523164	missense	probably benign	0.02
R4809:Ptch1	UTSW	13	63513708	missense	probably damaging	0.98
R4904:Ptch1	UTSW	13	63523004	missense	probably damaging	1.00
R4911:Ptch1	UTSW	13	63523052	missense	probably damaging	1.00
R4942:Ptch1	UTSW	13	63525070	missense	probably benign	0.02
R5386:Ptch1	UTSW	13	63545043	missense	probably damaging	0.98
R5447:Ptch1	UTSW	13	63527245	missense	probably benign
R5604:Ptch1	UTSW	13	63525122	missense	probably benign	0.01
R5846:Ptch1	UTSW	13	63565454	unclassified	probably benign
R5926:Ptch1	UTSW	13	63545055	missense	probably benign	0.01
R5945:Ptch1	UTSW	13	63573419	utr 5 prime	probably benign
R5957:Ptch1	UTSW	13	63525115	missense	probably damaging	1.00
R6326:Ptch1	UTSW	13	63543545	missense	probably damaging	1.00
R6376:Ptch1	UTSW	13	63543608	missense	possibly damaging	0.68
R6599:Ptch1	UTSW	13	63523104	missense	probably damaging	0.98
R6615:Ptch1	UTSW	13	63539830	missense	possibly damaging	0.46
R6965:Ptch1	UTSW	13	63525067	missense	possibly damaging	0.63
R7149:Ptch1	UTSW	13	63511736	missense	probably benign	0.23
R7168:Ptch1	UTSW	13	63512060	missense	probably benign
R7257:Ptch1	UTSW	13	63573294	missense	not run
R7258:Ptch1	UTSW	13	63573294	missense	not run
R7259:Ptch1	UTSW	13	63573294	missense	not run
R7368:Ptch1	UTSW	13	63511984	missense	probably benign	0.06
R7525:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7528:Ptch1	UTSW	13	63511714	missense	probably benign	0.00
R7820:Ptch1	UTSW	13	63523061	missense	probably damaging	1.00
R8077:Ptch1	UTSW	13	63540812	missense	probably damaging	0.98
R8373:Ptch1	UTSW	13	63541168	missense	probably damaging	1.00
R8398:Ptch1	UTSW	13	63525125	missense	probably benign	0.06
R8407:Ptch1	UTSW	13	63514243	missense	probably null	1.00
R8839:Ptch1	UTSW	13	63541224	missense	probably damaging	1.00
R9075:Ptch1	UTSW	13	63533521	missense	possibly damaging	0.87
R9476:Ptch1	UTSW	13	63533634	missense	probably benign	0.05
R9514:Ptch1	UTSW	13	63527257	missense	probably benign
R9528:Ptch1	UTSW	13	63513801	missense	probably benign	0.00
R9568:Ptch1	UTSW	13	63542173	missense	probably damaging	0.99
Z1177:Ptch1	UTSW	13	63520279	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTACACAAGAGCCTGCTCC -3'
(R):5'- CTGCGGGTCAACAAACGTAAC -3'

Sequencing Primer
(F):5'- TGCCACAGGACAAATGAATCTTC -3'
(R):5'- CGTAACATTTTTAATTGGAAACCTCC -3'

Posted On

2018-04-27