Incidental Mutation 'R6358:Erbin'
ID513361
Institutional Source Beutler Lab
Gene Symbol Erbin
Ensembl Gene ENSMUSG00000021709
Gene NameErbb2 interacting protein
Synonyms1700028E05Rik, Erbb2ip, Erbin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location103818787-103920514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103845565 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 456 (Q456L)
Ref Sequence ENSEMBL: ENSMUSP00000140931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022222] [ENSMUST00000053927] [ENSMUST00000091269] [ENSMUST00000169083] [ENSMUST00000188997] [ENSMUST00000191275]
Predicted Effect probably damaging
Transcript: ENSMUST00000022222
AA Change: Q456L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022222
Gene: ENSMUSG00000021709
AA Change: Q456L

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1294 1374 3.6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000053927
AA Change: Q456L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057956
Gene: ENSMUSG00000021709
AA Change: Q456L

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1368 1448 3.6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091269
AA Change: Q456L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088813
Gene: ENSMUSG00000021709
AA Change: Q456L

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1320 1400 3.6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169083
AA Change: Q456L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127607
Gene: ENSMUSG00000021709
AA Change: Q456L

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1329 1409 3.6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188997
AA Change: Q456L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140931
Gene: ENSMUSG00000021709
AA Change: Q456L

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1212 1292 3.6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189323
Predicted Effect probably damaging
Transcript: ENSMUST00000191275
AA Change: Q456L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140536
Gene: ENSMUSG00000021709
AA Change: Q456L

DomainStartEndE-ValueType
LRR 48 68 3.65e0 SMART
LRR 91 114 4.97e0 SMART
LRR 137 159 4.21e1 SMART
LRR 160 182 8.97e0 SMART
LRR 183 205 1.41e0 SMART
LRR 206 228 3.87e1 SMART
LRR 229 252 1.31e0 SMART
LRR 253 274 3.56e2 SMART
LRR 275 298 1.19e1 SMART
LRR 321 344 2.76e1 SMART
LRR 345 366 3.27e2 SMART
LRR 367 389 1.06e1 SMART
low complexity region 534 544 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
low complexity region 625 642 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
PDZ 1368 1448 3.6e-16 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat and PDZ domain (LAP) family. The encoded protein contains 17 leucine-rich repeats and one PDZ domain. It binds to the unphosphorylated form of the ERBB2 protein and regulates ERBB2 function and localization. It has also been shown to affect the Ras signaling pathway by disrupting Ras-Raf interaction. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null or gene trapped allele exhibit impaired myelination, reduced nerve conduction, and hyporesponsiveness to tactile stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Erbin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Erbin APN 13 103834012 missense probably damaging 1.00
IGL01404:Erbin APN 13 103839464 missense probably damaging 1.00
IGL01455:Erbin APN 13 103859387 missense probably damaging 1.00
IGL01871:Erbin APN 13 103834766 missense probably damaging 0.98
IGL01930:Erbin APN 13 103841172 missense probably damaging 1.00
IGL02112:Erbin APN 13 103862336 missense probably benign 0.12
IGL02736:Erbin APN 13 103839395 missense probably damaging 1.00
IGL03149:Erbin APN 13 103841163 missense possibly damaging 0.82
IGL03169:Erbin APN 13 103841232 missense possibly damaging 0.93
IGL02802:Erbin UTSW 13 103868130 missense probably damaging 1.00
PIT1430001:Erbin UTSW 13 103859509 missense probably damaging 1.00
R0329:Erbin UTSW 13 103868865 missense probably damaging 1.00
R0330:Erbin UTSW 13 103868865 missense probably damaging 1.00
R0492:Erbin UTSW 13 103834358 missense probably damaging 0.98
R0508:Erbin UTSW 13 103834027 missense probably damaging 1.00
R0589:Erbin UTSW 13 103886287 missense probably damaging 1.00
R1103:Erbin UTSW 13 103886202 missense probably benign 0.00
R1139:Erbin UTSW 13 103884253 missense probably damaging 1.00
R1316:Erbin UTSW 13 103841234 missense possibly damaging 0.94
R1675:Erbin UTSW 13 103841178 missense probably damaging 1.00
R1698:Erbin UTSW 13 103833731 missense possibly damaging 0.91
R1727:Erbin UTSW 13 103827968 missense probably benign 0.01
R1745:Erbin UTSW 13 103839449 missense probably damaging 1.00
R1746:Erbin UTSW 13 103850831 missense probably damaging 1.00
R1764:Erbin UTSW 13 103843451 splice site probably benign
R1828:Erbin UTSW 13 103860069 critical splice donor site probably null
R1840:Erbin UTSW 13 103834947 missense probably benign 0.01
R1987:Erbin UTSW 13 103886203 missense probably benign 0.36
R1992:Erbin UTSW 13 103833713 missense probably benign 0.33
R2013:Erbin UTSW 13 103857533 missense probably damaging 1.00
R2025:Erbin UTSW 13 103830195 missense probably benign 0.01
R2056:Erbin UTSW 13 103830316 missense probably benign 0.27
R2171:Erbin UTSW 13 103834958 missense probably benign 0.00
R2366:Erbin UTSW 13 103844909 missense probably damaging 1.00
R2897:Erbin UTSW 13 103886197 missense probably damaging 1.00
R3912:Erbin UTSW 13 103862287 missense probably benign 0.35
R3912:Erbin UTSW 13 103886338 splice site probably benign
R4073:Erbin UTSW 13 103860111 missense probably damaging 1.00
R4458:Erbin UTSW 13 103833557 missense probably damaging 1.00
R4465:Erbin UTSW 13 103844885 missense probably benign 0.05
R4525:Erbin UTSW 13 103857092 missense probably benign
R4780:Erbin UTSW 13 103884206 missense probably damaging 1.00
R4877:Erbin UTSW 13 103850838 missense probably damaging 0.99
R4879:Erbin UTSW 13 103834774 missense probably benign 0.05
R5396:Erbin UTSW 13 103857409 critical splice donor site probably null
R5898:Erbin UTSW 13 103839305 critical splice donor site probably null
R5955:Erbin UTSW 13 103830192 missense probably benign 0.40
R6073:Erbin UTSW 13 103844921 nonsense probably null
R6107:Erbin UTSW 13 103833892 missense probably benign 0.06
R6257:Erbin UTSW 13 103862288 missense probably benign 0.35
R6294:Erbin UTSW 13 103857056 missense probably benign 0.36
R6476:Erbin UTSW 13 103841247 missense probably damaging 1.00
R6485:Erbin UTSW 13 103868113 missense probably damaging 1.00
R6631:Erbin UTSW 13 103824892 missense probably benign 0.02
R6735:Erbin UTSW 13 103884210 missense probably damaging 1.00
R6736:Erbin UTSW 13 103834766 missense possibly damaging 0.72
R6749:Erbin UTSW 13 103834377 missense probably damaging 1.00
R7290:Erbin UTSW 13 103862326 missense probably damaging 1.00
R7767:Erbin UTSW 13 103859399 missense probably damaging 1.00
R8052:Erbin UTSW 13 103834356 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTCTCTGTAACTGCAGGTAG -3'
(R):5'- ACTCAAAACCTATGTGTTTGCAGTG -3'

Sequencing Primer
(F):5'- TCTCTGTAACTGCAGGTAGTATAAC -3'
(R):5'- GCTGGAATTAAAGGCATGCGTTATC -3'
Posted On2018-04-27