Incidental Mutation 'R6358:Olfr736'
ID513363
Institutional Source Beutler Lab
Gene Symbol Olfr736
Ensembl Gene ENSMUSG00000047716
Gene Nameolfactory receptor 736
SynonymsMOR106-5, GA_x6K02T2PMLR-6089963-6090901
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50381163-50394192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50393388 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 211 (I211F)
Ref Sequence ENSEMBL: ENSMUSP00000149654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058965] [ENSMUST00000213402] [ENSMUST00000213755] [ENSMUST00000215227] [ENSMUST00000215263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058965
AA Change: I211F

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062700
Gene: ENSMUSG00000047716
AA Change: I211F

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.5e-45 PFAM
Pfam:7TM_GPCR_Srsx 37 175 6.9e-7 PFAM
Pfam:7tm_1 43 294 4.7e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213402
AA Change: I211F

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213755
AA Change: I211F

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215227
AA Change: I211F

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215263
AA Change: I211F

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.2842 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Olfr736
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Olfr736 APN 14 50392834 missense probably benign 0.33
IGL01952:Olfr736 APN 14 50393403 missense probably benign 0.02
IGL01996:Olfr736 APN 14 50393659 missense probably damaging 0.99
IGL02694:Olfr736 APN 14 50392800 missense probably benign 0.02
IGL02717:Olfr736 APN 14 50393647 missense probably damaging 1.00
IGL03185:Olfr736 APN 14 50393398 missense probably damaging 0.99
IGL03218:Olfr736 APN 14 50393658 missense probably damaging 0.98
IGL03048:Olfr736 UTSW 14 50392788 missense possibly damaging 0.47
R0066:Olfr736 UTSW 14 50393202 missense probably benign 0.08
R0066:Olfr736 UTSW 14 50393202 missense probably benign 0.08
R0089:Olfr736 UTSW 14 50392864 missense probably benign
R0254:Olfr736 UTSW 14 50393079 missense probably damaging 0.99
R0284:Olfr736 UTSW 14 50392995 missense probably damaging 1.00
R1800:Olfr736 UTSW 14 50393329 nonsense probably null
R3885:Olfr736 UTSW 14 50392869 missense probably benign 0.05
R4302:Olfr736 UTSW 14 50393446 missense probably benign 0.23
R4452:Olfr736 UTSW 14 50392912 missense probably benign
R4705:Olfr736 UTSW 14 50392800 missense probably benign 0.02
R5340:Olfr736 UTSW 14 50393220 missense probably damaging 0.98
R6007:Olfr736 UTSW 14 50393491 missense probably damaging 1.00
R6338:Olfr736 UTSW 14 50393400 missense possibly damaging 0.47
R6521:Olfr736 UTSW 14 50393548 missense possibly damaging 0.95
R6527:Olfr736 UTSW 14 50393428 nonsense probably null
R6777:Olfr736 UTSW 14 50393658 missense probably damaging 0.98
R6903:Olfr736 UTSW 14 50393632 missense possibly damaging 0.48
X0026:Olfr736 UTSW 14 50393541 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GTCATGACCACTATGTTCTGTGG -3'
(R):5'- TGTCCTGATCCTGGGCTTAC -3'

Sequencing Primer
(F):5'- GACCACTATGTTCTGTGGCAACC -3'
(R):5'- CCTGGGCTTACATATGTTATCATGAC -3'
Posted On2018-04-27