Mutagenetix > Incidental Mutation

Incidental Mutation 'R6358:Ppl'

513364

Institutional Source

Beutler Lab

Gene Symbol

Ppl

Ensembl Gene

ENSMUSG00000039457

Gene Name

periplakin

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_008909

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6358 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

5086291-5132421 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 5087929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 1501 (E1501*)

Ref Sequence

ENSEMBL: ENSMUSP00000039360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035672] [ENSMUST00000052449] [ENSMUST00000229126] [ENSMUST00000230703]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000035672
AA Change: E1501*

SMART Domains

Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: E1501*

Domain	Start	End	E-Value	Type
SPEC	123	211	1.58e0	SMART
SPEC	214	315	3.38e-2	SMART
SPEC	321	483	1.11e-2	SMART
SPEC	503	610	4.96e0	SMART
Blast:SPEC	613	717	5e-59	BLAST
low complexity region	718	729	N/A	INTRINSIC
Blast:SPEC	732	859	2e-60	BLAST
low complexity region	893	908	N/A	INTRINSIC
low complexity region	963	982	N/A	INTRINSIC
internal_repeat_2	984	1004	3.46e-5	PROSPERO
internal_repeat_1	992	1008	8.09e-7	PROSPERO
low complexity region	1011	1020	N/A	INTRINSIC
low complexity region	1027	1042	N/A	INTRINSIC
internal_repeat_1	1112	1128	8.09e-7	PROSPERO
coiled coil region	1180	1279	N/A	INTRINSIC
low complexity region	1346	1355	N/A	INTRINSIC
low complexity region	1386	1433	N/A	INTRINSIC
low complexity region	1455	1479	N/A	INTRINSIC
Blast:SPEC	1529	1610	8e-30	BLAST
low complexity region	1612	1630	N/A	INTRINSIC
PLEC	1649	1683	1.34e-5	SMART
PLEC	1698	1733	2.23e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000052449

SMART Domains

Protein: ENSMUSP00000061843
Gene: ENSMUSG00000039473

Domain	Start	End	E-Value	Type
Pfam:HUN	117	168	1.4e-22	PFAM
low complexity region	181	224	N/A	INTRINSIC
low complexity region	232	238	N/A	INTRINSIC
low complexity region	250	267	N/A	INTRINSIC
low complexity region	331	344	N/A	INTRINSIC
Pfam:UBN_AB	353	573	2.4e-80	PFAM
low complexity region	792	804	N/A	INTRINSIC
low complexity region	856	882	N/A	INTRINSIC
low complexity region	905	934	N/A	INTRINSIC
low complexity region	970	984	N/A	INTRINSIC
low complexity region	996	1006	N/A	INTRINSIC
low complexity region	1016	1034	N/A	INTRINSIC
low complexity region	1084	1098	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229126

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229386

Predicted Effect

probably benign
Transcript: ENSMUST00000230703

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam39	T	C	8: 40,826,681	V703A	probably benign	Het
Adgrv1	T	A	13: 81,414,583	Q5389L	probably damaging	Het
Aldh18a1	A	T	19: 40,577,678	I42N	possibly damaging	Het
Ankrd28	A	C	14: 31,710,864	C575W	probably damaging	Het
Car14	T	A	3: 95,898,175	T329S	possibly damaging	Het
Cdhr2	T	C	13: 54,736,546	F1298S	probably damaging	Het
Crhr2	A	G	6: 55,093,043	I341T	probably benign	Het
D5Ertd579e	T	A	5: 36,616,236		probably null	Het
Emilin1	A	G	5: 30,918,218	E601G	probably damaging	Het
Erbin	T	A	13: 103,845,565	Q456L	probably damaging	Het
Glp1r	T	C	17: 30,932,644	V405A	probably benign	Het
Gm10220	C	G	5: 26,120,305		probably null	Het
Gm2016	A	G	12: 87,877,000	E139G	unknown	Het
Gm527	A	T	12: 64,923,548	H219L	possibly damaging	Het
Gorasp2	T	A	2: 70,672,760	M1K	probably null	Het
H2-DMa	T	A	17: 34,137,984	L152H	probably damaging	Het
Hsd3b7	T	A	7: 127,801,537	H54Q	probably damaging	Het
Hspa12b	T	C	2: 131,137,066		probably benign	Het
Iars	C	A	13: 49,727,143	T1006K	possibly damaging	Het
Jmjd1c	T	C	10: 67,225,939	V1357A	probably benign	Het
Magi3	T	C	3: 104,050,952	M606V	probably damaging	Het
Mia	T	C	7: 27,180,978	D24G	probably benign	Het
Mon2	A	T	10: 123,013,504	L1297Q	probably damaging	Het
Musk	T	A	4: 58,373,171	S691T	possibly damaging	Het
Myo5c	A	T	9: 75,296,012	E1463D	possibly damaging	Het
Ndufs6	C	T	13: 73,320,319	G87D	probably damaging	Het
Npnt	C	T	3: 132,904,718	V415I	probably benign	Het
Ntsr2	A	G	12: 16,656,768	I266V	probably benign	Het
Olfr259	T	C	2: 87,108,434		probably benign	Het
Olfr736	A	T	14: 50,393,388	I211F	possibly damaging	Het
Pkmyt1	T	A	17: 23,733,656		probably null	Het
Polr1e	T	C	4: 45,026,813	L166P	probably damaging	Het
Ppib	T	G	9: 66,061,474	F48C	probably damaging	Het
Prpf8	T	C	11: 75,491,495	V384A	probably benign	Het
Ptch1	T	G	13: 63,513,689	S1212R	probably damaging	Het
Ralb	C	A	1: 119,476,005	D131Y	probably damaging	Het
Rfx4	T	A	10: 84,844,235	M141K	probably damaging	Het
Rgl2	T	A	17: 33,937,131		probably null	Het
Rpl27	A	G	11: 101,443,956		probably benign	Het
Sdc1	A	C	12: 8,791,297	T213P	probably damaging	Het
Setx	T	A	2: 29,171,348	N2256K	possibly damaging	Het
Shank2	A	G	7: 144,031,297	M12V	probably benign	Het
Slc22a28	T	A	19: 8,071,888	K332M	probably damaging	Het
Slf2	A	T	19: 44,935,425	H226L	probably benign	Het
Tbc1d10b	T	C	7: 127,203,412	S362G	probably benign	Het
Tbxas1	G	A	6: 38,952,112		probably benign	Het
Tctn1	A	G	5: 122,261,512	V83A	probably damaging	Het
Tgm4	A	G	9: 123,056,518	E375G	probably damaging	Het
Tmeff2	T	A	1: 51,133,114	Y247*	probably null	Het
Tmem167b	C	T	3: 108,558,895	R79H	possibly damaging	Het
Tmprss7	T	G	16: 45,669,573	M429L	probably benign	Het
Tnfsf18	T	A	1: 161,503,579	D99E	probably benign	Het
Tnrc18	A	T	5: 142,727,981	S2534T	probably damaging	Het
Tnxb	A	G	17: 34,678,994	E872G	probably damaging	Het
Tomm40l	C	T	1: 171,219,637	V237I	possibly damaging	Het
Trbv2	A	G	6: 41,047,902	Q84R	probably benign	Het
Tspan18	T	C	2: 93,209,874	R179G	probably benign	Het
Tspan8	G	T	10: 115,833,227	V56L	probably benign	Het
Zbtb22	T	C	17: 33,918,737	S619P	probably damaging	Het
Zfp2	A	T	11: 50,900,601	I205N	probably damaging	Het
Zfpm1	A	G	8: 122,337,111		probably benign	Het

Other mutations in Ppl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ppl	APN	16	5089545	missense	probably benign	0.41
IGL00484:Ppl	APN	16	5087952	missense	probably benign	0.13
IGL00654:Ppl	APN	16	5087308	missense	possibly damaging	0.94
IGL00832:Ppl	APN	16	5088975	missense	probably damaging	1.00
IGL01104:Ppl	APN	16	5094491	missense	probably benign	0.01
IGL01327:Ppl	APN	16	5087644	missense	probably benign	0.19
IGL01644:Ppl	APN	16	5091855	missense	probably damaging	1.00
IGL01824:Ppl	APN	16	5087889	missense	probably damaging	1.00
IGL02071:Ppl	APN	16	5113072	missense	probably benign	0.04
IGL02085:Ppl	APN	16	5089816	missense	probably benign	0.09
IGL02282:Ppl	APN	16	5101458	missense	probably damaging	1.00
IGL02635:Ppl	APN	16	5089767	missense	probably benign	0.01
IGL02649:Ppl	APN	16	5087463	missense	probably damaging	1.00
IGL02888:Ppl	APN	16	5100407	missense	possibly damaging	0.89
IGL03305:Ppl	APN	16	5093233	missense	possibly damaging	0.62
G4846:Ppl	UTSW	16	5087206	missense	probably damaging	1.00
IGL03097:Ppl	UTSW	16	5096726	missense	probably damaging	0.98
R0759:Ppl	UTSW	16	5089777	missense	probably benign	0.00
R0786:Ppl	UTSW	16	5089054	missense	probably damaging	1.00
R1024:Ppl	UTSW	16	5100000	missense	probably damaging	1.00
R1498:Ppl	UTSW	16	5104765	missense	probably benign	0.05
R1544:Ppl	UTSW	16	5102597	nonsense	probably null
R1597:Ppl	UTSW	16	5107574	missense	probably benign	0.20
R1863:Ppl	UTSW	16	5087980	missense	possibly damaging	0.69
R1921:Ppl	UTSW	16	5106124	missense	possibly damaging	0.80
R2230:Ppl	UTSW	16	5088981	missense	possibly damaging	0.51
R2275:Ppl	UTSW	16	5094552	missense	probably benign	0.00
R2355:Ppl	UTSW	16	5094497	missense	probably benign	0.00
R3410:Ppl	UTSW	16	5107517	missense	possibly damaging	0.81
R3737:Ppl	UTSW	16	5106857	missense	probably benign
R3797:Ppl	UTSW	16	5104550	splice site	probably benign
R3968:Ppl	UTSW	16	5100332	splice site	probably null
R3970:Ppl	UTSW	16	5100332	splice site	probably null
R4034:Ppl	UTSW	16	5106857	missense	probably benign
R4583:Ppl	UTSW	16	5104536	missense	probably benign	0.02
R4639:Ppl	UTSW	16	5089446	missense	probably damaging	1.00
R4762:Ppl	UTSW	16	5088982	missense	probably benign	0.00
R4828:Ppl	UTSW	16	5104926	missense	probably damaging	1.00
R4869:Ppl	UTSW	16	5104889	missense	probably damaging	0.99
R4925:Ppl	UTSW	16	5104982	missense	probably damaging	1.00
R4983:Ppl	UTSW	16	5088718	missense	possibly damaging	0.75
R4984:Ppl	UTSW	16	5087641	missense	probably benign
R4997:Ppl	UTSW	16	5089371	missense	probably damaging	1.00
R5072:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5073:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5074:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5286:Ppl	UTSW	16	5089123	nonsense	probably null
R5398:Ppl	UTSW	16	5104922	missense	probably benign	0.00
R5448:Ppl	UTSW	16	5107566	missense	probably benign
R5664:Ppl	UTSW	16	5106055	missense	probably benign	0.00
R5873:Ppl	UTSW	16	5106049	critical splice donor site	probably null
R5918:Ppl	UTSW	16	5104901	missense	probably benign	0.00
R5951:Ppl	UTSW	16	5088628	missense	probably benign	0.25
R6038:Ppl	UTSW	16	5102581	missense	possibly damaging	0.94
R6038:Ppl	UTSW	16	5102581	missense	possibly damaging	0.94
R6088:Ppl	UTSW	16	5104988	missense	possibly damaging	0.73
R6149:Ppl	UTSW	16	5107596	nonsense	probably null
R6379:Ppl	UTSW	16	5097691	missense	probably benign	0.02
R6468:Ppl	UTSW	16	5092441	missense	probably damaging	1.00
R6514:Ppl	UTSW	16	5087317	missense	probably damaging	1.00
R6528:Ppl	UTSW	16	5087616	missense	probably benign	0.00
R6703:Ppl	UTSW	16	5089464	missense	probably damaging	0.99
R6721:Ppl	UTSW	16	5107469	missense	probably damaging	0.97
R6811:Ppl	UTSW	16	5089144	missense	probably damaging	0.99
R6934:Ppl	UTSW	16	5094509	missense	probably benign	0.00
R7034:Ppl	UTSW	16	5087502	missense	probably benign	0.29
R7076:Ppl	UTSW	16	5100119	missense	probably damaging	1.00
R7300:Ppl	UTSW	16	5102371	missense	possibly damaging	0.87
R7349:Ppl	UTSW	16	5104729	missense	probably damaging	0.99
R7359:Ppl	UTSW	16	5089341	missense	possibly damaging	0.78
R7378:Ppl	UTSW	16	5112996	missense	possibly damaging	0.91
R7383:Ppl	UTSW	16	5097971	missense	probably damaging	1.00
R7389:Ppl	UTSW	16	5106713	splice site	probably null
R7445:Ppl	UTSW	16	5089068	missense	probably damaging	1.00
R7687:Ppl	UTSW	16	5097942	missense	probably benign	0.00
R7752:Ppl	UTSW	16	5102302	missense	probably benign	0.09
R7827:Ppl	UTSW	16	5087964	missense	probably damaging	1.00
R7836:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7842:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7896:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7898:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7943:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R8122:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R8126:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R8284:Ppl	UTSW	16	5132337	missense	probably damaging	1.00
R8680:Ppl	UTSW	16	5087436	missense	probably benign	0.01
R8781:Ppl	UTSW	16	5097936	missense	possibly damaging	0.68
R8835:Ppl	UTSW	16	5088990	missense	probably damaging	0.99
R8836:Ppl	UTSW	16	5088990	missense	probably damaging	0.99
R8837:Ppl	UTSW	16	5088990	missense	probably damaging	0.99
R8866:Ppl	UTSW	16	5102347	missense	probably benign	0.12
R8894:Ppl	UTSW	16	5107342	intron	probably benign
R8922:Ppl	UTSW	16	5105951	missense	probably benign
R8927:Ppl	UTSW	16	5087610	missense	probably benign	0.19
R8928:Ppl	UTSW	16	5087610	missense	probably benign	0.19
R9070:Ppl	UTSW	16	5089344	missense	probably benign	0.00
R9314:Ppl	UTSW	16	5104503	missense	possibly damaging	0.79
R9642:Ppl	UTSW	16	5097738	missense	probably benign	0.01
RF009:Ppl	UTSW	16	5097931	missense	probably benign	0.00
X0054:Ppl	UTSW	16	5104902	missense	probably benign	0.00
Z1088:Ppl	UTSW	16	5089507	missense	probably damaging	0.97
Z1176:Ppl	UTSW	16	5106778	missense	probably damaging	0.99
Z1177:Ppl	UTSW	16	5097957	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATTGGAGTCTCCGGGTCTCTAG -3'
(R):5'- CACAAAAGGTGGTGCTGCAG -3'

Sequencing Primer
(F):5'- GGTTTTCTTCTCTCAGGAAGTCCAG -3'
(R):5'- TGCAGCAGGACCCACAG -3'

Posted On

2018-04-27