Incidental Mutation 'R6358:H2-DMa'
ID 513370
Institutional Source Beutler Lab
Gene Symbol H2-DMa
Ensembl Gene ENSMUSG00000037649
Gene Name histocompatibility 2, class II, locus DMa
Synonyms H2-M alpha, H2-Ma, H-2Ma
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock # R6358 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 34135182-34139101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34137984 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 152 (L152H)
Ref Sequence ENSEMBL: ENSMUSP00000037088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042121]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000042121
AA Change: L152H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037088
Gene: ENSMUSG00000037649
AA Change: L152H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_alpha 42 123 2.83e-19 SMART
IGc1 142 212 5.82e-23 SMART
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173907
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired antigen presenting cell function, poor IgG responses to T-dependent antigens, reduced numbers of mature CD4+ T cells, and increased susceptibility to Leishmania major infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Aldh18a1 A T 19: 40,577,678 I42N possibly damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in H2-DMa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03286:H2-DMa APN 17 34137109 splice site probably null
R0422:H2-DMa UTSW 17 34137947 missense probably damaging 1.00
R0620:H2-DMa UTSW 17 34137960 missense probably damaging 0.96
R1240:H2-DMa UTSW 17 34138406 critical splice acceptor site probably null
R1483:H2-DMa UTSW 17 34135750 missense possibly damaging 0.61
R1656:H2-DMa UTSW 17 34138142 missense possibly damaging 0.92
R1657:H2-DMa UTSW 17 34137399 critical splice donor site probably null
R1696:H2-DMa UTSW 17 34138413 missense probably benign 0.44
R2884:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R2886:H2-DMa UTSW 17 34137147 missense probably damaging 1.00
R5024:H2-DMa UTSW 17 34138487 missense possibly damaging 0.77
R5236:H2-DMa UTSW 17 34137939 missense probably damaging 1.00
R5632:H2-DMa UTSW 17 34138001 missense probably benign 0.14
R6423:H2-DMa UTSW 17 34137196 missense probably benign 0.05
R7033:H2-DMa UTSW 17 34136997 splice site probably null
R7387:H2-DMa UTSW 17 34138127 missense probably damaging 1.00
R8060:H2-DMa UTSW 17 34137285 missense probably benign 0.05
R8504:H2-DMa UTSW 17 34138442 missense probably damaging 1.00
R8813:H2-DMa UTSW 17 34135760 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TCCACACAGTGTCCTAGCTG -3'
(R):5'- ATCTCGTGTGTCACAGTGC -3'

Sequencing Primer
(F):5'- CAGTTTTTGCCGGGAAGACC -3'
(R):5'- CGTGTGTCACAGTGCAGGAG -3'
Posted On 2018-04-27