Incidental Mutation 'R6358:Aldh18a1'
ID513373
Institutional Source Beutler Lab
Gene Symbol Aldh18a1
Ensembl Gene ENSMUSG00000025007
Gene Namealdehyde dehydrogenase 18 family, member A1
Synonyms2810433K04Rik, Pycs
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6358 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location40550257-40588463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40577678 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 42 (I42N)
Ref Sequence ENSEMBL: ENSMUSP00000135417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025979] [ENSMUST00000149476] [ENSMUST00000175932] [ENSMUST00000176939] [ENSMUST00000176955]
Predicted Effect probably benign
Transcript: ENSMUST00000025979
AA Change: I153N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025979
Gene: ENSMUSG00000025007
AA Change: I153N

DomainStartEndE-ValueType
Pfam:AA_kinase 71 329 1e-41 PFAM
Pfam:Aldedh 350 659 3.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134749
Predicted Effect possibly damaging
Transcript: ENSMUST00000149476
AA Change: I153N

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115429
Gene: ENSMUSG00000025007
AA Change: I153N

DomainStartEndE-ValueType
Pfam:AA_kinase 71 173 3.3e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000175932
AA Change: I42N

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000176939
AA Change: I153N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135426
Gene: ENSMUSG00000025007
AA Change: I153N

DomainStartEndE-ValueType
Pfam:AA_kinase 71 327 1.9e-39 PFAM
Pfam:Aldedh 351 665 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176955
AA Change: I42N

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135759
Gene: ENSMUSG00000025007
AA Change: I42N

DomainStartEndE-ValueType
PDB:4Q1T|D 1 83 1e-5 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aldehyde dehydrogenase family and encodes a bifunctional ATP- and NADPH-dependent mitochondrial enzyme with both gamma-glutamyl kinase and gamma-glutamyl phosphate reductase activities. The encoded protein catalyzes the reduction of glutamate to delta1-pyrroline-5-carboxylate, a critical step in the de novo biosynthesis of proline, ornithine and arginine. Mutations in this gene lead to hyperammonemia, hypoornithinemia, hypocitrullinemia, hypoargininemia and hypoprolinemia and may be associated with neurodegeneration, cataracts and connective tissue diseases. Alternatively spliced transcript variants, encoding different isoforms, have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 40,826,681 V703A probably benign Het
Adgrv1 T A 13: 81,414,583 Q5389L probably damaging Het
Ankrd28 A C 14: 31,710,864 C575W probably damaging Het
Car14 T A 3: 95,898,175 T329S possibly damaging Het
Cdhr2 T C 13: 54,736,546 F1298S probably damaging Het
Crhr2 A G 6: 55,093,043 I341T probably benign Het
D5Ertd579e T A 5: 36,616,236 probably null Het
Emilin1 A G 5: 30,918,218 E601G probably damaging Het
Erbin T A 13: 103,845,565 Q456L probably damaging Het
Glp1r T C 17: 30,932,644 V405A probably benign Het
Gm10220 C G 5: 26,120,305 probably null Het
Gm2016 A G 12: 87,877,000 E139G unknown Het
Gm527 A T 12: 64,923,548 H219L possibly damaging Het
Gorasp2 T A 2: 70,672,760 M1K probably null Het
H2-DMa T A 17: 34,137,984 L152H probably damaging Het
Hsd3b7 T A 7: 127,801,537 H54Q probably damaging Het
Hspa12b T C 2: 131,137,066 probably benign Het
Iars C A 13: 49,727,143 T1006K possibly damaging Het
Jmjd1c T C 10: 67,225,939 V1357A probably benign Het
Magi3 T C 3: 104,050,952 M606V probably damaging Het
Mia T C 7: 27,180,978 D24G probably benign Het
Mon2 A T 10: 123,013,504 L1297Q probably damaging Het
Musk T A 4: 58,373,171 S691T possibly damaging Het
Myo5c A T 9: 75,296,012 E1463D possibly damaging Het
Ndufs6 C T 13: 73,320,319 G87D probably damaging Het
Npnt C T 3: 132,904,718 V415I probably benign Het
Ntsr2 A G 12: 16,656,768 I266V probably benign Het
Olfr259 T C 2: 87,108,434 probably benign Het
Olfr736 A T 14: 50,393,388 I211F possibly damaging Het
Pkmyt1 T A 17: 23,733,656 probably null Het
Polr1e T C 4: 45,026,813 L166P probably damaging Het
Ppib T G 9: 66,061,474 F48C probably damaging Het
Ppl C A 16: 5,087,929 E1501* probably null Het
Prpf8 T C 11: 75,491,495 V384A probably benign Het
Ptch1 T G 13: 63,513,689 S1212R probably damaging Het
Ralb C A 1: 119,476,005 D131Y probably damaging Het
Rfx4 T A 10: 84,844,235 M141K probably damaging Het
Rgl2 T A 17: 33,937,131 probably null Het
Rpl27 A G 11: 101,443,956 probably benign Het
Sdc1 A C 12: 8,791,297 T213P probably damaging Het
Setx T A 2: 29,171,348 N2256K possibly damaging Het
Shank2 A G 7: 144,031,297 M12V probably benign Het
Slc22a28 T A 19: 8,071,888 K332M probably damaging Het
Slf2 A T 19: 44,935,425 H226L probably benign Het
Tbc1d10b T C 7: 127,203,412 S362G probably benign Het
Tbxas1 G A 6: 38,952,112 probably benign Het
Tctn1 A G 5: 122,261,512 V83A probably damaging Het
Tgm4 A G 9: 123,056,518 E375G probably damaging Het
Tmeff2 T A 1: 51,133,114 Y247* probably null Het
Tmem167b C T 3: 108,558,895 R79H possibly damaging Het
Tmprss7 T G 16: 45,669,573 M429L probably benign Het
Tnfsf18 T A 1: 161,503,579 D99E probably benign Het
Tnrc18 A T 5: 142,727,981 S2534T probably damaging Het
Tnxb A G 17: 34,678,994 E872G probably damaging Het
Tomm40l C T 1: 171,219,637 V237I possibly damaging Het
Trbv2 A G 6: 41,047,902 Q84R probably benign Het
Tspan18 T C 2: 93,209,874 R179G probably benign Het
Tspan8 G T 10: 115,833,227 V56L probably benign Het
Zbtb22 T C 17: 33,918,737 S619P probably damaging Het
Zfp2 A T 11: 50,900,601 I205N probably damaging Het
Zfpm1 A G 8: 122,337,111 probably benign Het
Other mutations in Aldh18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Aldh18a1 APN 19 40569181 splice site probably benign
IGL02353:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02360:Aldh18a1 APN 19 40577920 missense probably damaging 0.98
IGL02974:Aldh18a1 APN 19 40569084 missense probably damaging 0.96
IGL03295:Aldh18a1 APN 19 40562942 missense probably damaging 1.00
PIT4498001:Aldh18a1 UTSW 19 40574356 missense probably benign
R0267:Aldh18a1 UTSW 19 40573789 missense probably benign 0.25
R0498:Aldh18a1 UTSW 19 40574272 missense probably benign 0.29
R1140:Aldh18a1 UTSW 19 40574285 missense probably benign 0.01
R1142:Aldh18a1 UTSW 19 40551213 missense probably damaging 0.97
R1509:Aldh18a1 UTSW 19 40557483 missense probably damaging 0.98
R1640:Aldh18a1 UTSW 19 40585499 missense probably benign
R1721:Aldh18a1 UTSW 19 40564838 missense probably damaging 1.00
R3012:Aldh18a1 UTSW 19 40557691 nonsense probably null
R3085:Aldh18a1 UTSW 19 40574369 missense probably benign
R3815:Aldh18a1 UTSW 19 40570500 missense probably damaging 1.00
R3863:Aldh18a1 UTSW 19 40551314 missense probably damaging 1.00
R4156:Aldh18a1 UTSW 19 40551281 missense probably damaging 1.00
R5116:Aldh18a1 UTSW 19 40553505 missense probably benign
R5135:Aldh18a1 UTSW 19 40554817 intron probably benign
R5393:Aldh18a1 UTSW 19 40585567 missense probably benign 0.00
R5492:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5493:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5494:Aldh18a1 UTSW 19 40551290 missense probably damaging 1.00
R5957:Aldh18a1 UTSW 19 40570537 nonsense probably null
R6255:Aldh18a1 UTSW 19 40580043 missense possibly damaging 0.93
R6320:Aldh18a1 UTSW 19 40570561 missense probably benign 0.44
R6379:Aldh18a1 UTSW 19 40577770 critical splice donor site probably null
R6785:Aldh18a1 UTSW 19 40568344 missense probably damaging 1.00
R7334:Aldh18a1 UTSW 19 40551252 missense probably damaging 1.00
R7549:Aldh18a1 UTSW 19 40564847 missense probably damaging 1.00
R7935:Aldh18a1 UTSW 19 40573782 nonsense probably null
R7960:Aldh18a1 UTSW 19 40557820 missense probably benign 0.03
R8152:Aldh18a1 UTSW 19 40565012 missense probably benign 0.01
R8179:Aldh18a1 UTSW 19 40557508 missense probably damaging 1.00
R8181:Aldh18a1 UTSW 19 40557437 missense probably benign 0.27
R8222:Aldh18a1 UTSW 19 40573852 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGCAGTAGTAACTCTTGGG -3'
(R):5'- TGCGCCATGAGATCCTTCTG -3'

Sequencing Primer
(F):5'- AACCCTCTGATGTAGGCACTGATG -3'
(R):5'- ATGAGATCCTTCTGTCTCAGAGCG -3'
Posted On2018-04-27