Incidental Mutation 'R6364:B3galt1'
ID 513378
Institutional Source Beutler Lab
Gene Symbol B3galt1
Ensembl Gene ENSMUSG00000034780
Gene Name UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Synonyms 6330417G03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6364 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 67565871-68122689 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 68118672 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 244 (S244T)
Ref Sequence ENSEMBL: ENSMUSP00000107965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042456] [ENSMUST00000112346] [ENSMUST00000180887]
AlphaFold O54904
Predicted Effect probably damaging
Transcript: ENSMUST00000042456
AA Change: S244T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041343
Gene: ENSMUSG00000034780
AA Change: S244T

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Galactosyl_T 92 283 5.4e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112346
AA Change: S244T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107965
Gene: ENSMUSG00000034780
AA Change: S244T

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Galactosyl_T 92 283 6.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180887
SMART Domains Protein: ENSMUSP00000137947
Gene: ENSMUSG00000034780

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is expressed exclusively in the brain. The encoded protein shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in B3galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:B3galt1 APN 2 68117976 missense possibly damaging 0.94
IGL00834:B3galt1 APN 2 68118706 missense probably damaging 1.00
IGL02555:B3galt1 APN 2 68118561 missense probably benign 0.41
IGL02678:B3galt1 APN 2 68118910 missense probably benign 0.28
IGL02904:B3galt1 APN 2 68118745 missense probably damaging 0.99
IGL02931:B3galt1 APN 2 68118384 missense probably damaging 1.00
IGL03231:B3galt1 APN 2 68118603 missense probably damaging 1.00
R0483:B3galt1 UTSW 2 68118588 missense probably benign
R0735:B3galt1 UTSW 2 68118579 missense possibly damaging 0.46
R4946:B3galt1 UTSW 2 68118569 missense possibly damaging 0.91
R5327:B3galt1 UTSW 2 68118768 missense probably damaging 1.00
R5638:B3galt1 UTSW 2 68118751 missense probably damaging 0.99
R6960:B3galt1 UTSW 2 68118689 missense probably damaging 0.98
R7578:B3galt1 UTSW 2 68118552 missense probably damaging 1.00
R8112:B3galt1 UTSW 2 68118358 missense probably damaging 1.00
R8115:B3galt1 UTSW 2 68117976 missense possibly damaging 0.83
R8196:B3galt1 UTSW 2 68118186 missense probably benign 0.14
R8846:B3galt1 UTSW 2 68118373 missense probably benign 0.03
R8924:B3galt1 UTSW 2 68118715 missense probably benign 0.11
R9062:B3galt1 UTSW 2 68118546 missense
R9104:B3galt1 UTSW 2 68118062 missense probably benign
Z1177:B3galt1 UTSW 2 68117990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTCATGAAAACCGACAGTG -3'
(R):5'- TCTGGAGAGATCTGGTGGAC -3'

Sequencing Primer
(F):5'- CCGACAGTGACATTTTTGTGAAC -3'
(R):5'- CTGGTGGACAGTGATGACGC -3'
Posted On 2018-04-27