Incidental Mutation 'R6364:Ambra1'
ID 513380
Institutional Source Beutler Lab
Gene Symbol Ambra1
Ensembl Gene ENSMUSG00000040506
Gene Name autophagy/beclin 1 regulator 1
Synonyms 2310079H06Rik, D030051N19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock # R6364 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 91730134-91918849 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 91773316 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 548 (H548Q)
Ref Sequence ENSEMBL: ENSMUSP00000106948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045699] [ENSMUST00000045705] [ENSMUST00000099712] [ENSMUST00000111316] [ENSMUST00000111317]
AlphaFold A2AH22
Predicted Effect probably benign
Transcript: ENSMUST00000045699
AA Change: H457Q

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048898
Gene: ENSMUSG00000040506
AA Change: H457Q

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000045705
AA Change: H548Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049258
Gene: ENSMUSG00000040506
AA Change: H548Q

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
Blast:WD40 932 970 1e-5 BLAST
Blast:WD40 991 1038 1e-7 BLAST
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1122 1146 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099712
AA Change: H457Q

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097299
Gene: ENSMUSG00000040506
AA Change: H457Q

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 613 N/A INTRINSIC
low complexity region 665 672 N/A INTRINSIC
Blast:WD40 841 879 1e-5 BLAST
Blast:WD40 900 947 1e-7 BLAST
low complexity region 971 983 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
low complexity region 1156 1172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111316
AA Change: H548Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106948
Gene: ENSMUSG00000040506
AA Change: H548Q

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
Blast:WD40 872 910 1e-5 BLAST
Blast:WD40 931 978 1e-7 BLAST
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1062 1086 N/A INTRINSIC
low complexity region 1187 1203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111317
AA Change: H457Q

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106949
Gene: ENSMUSG00000040506
AA Change: H457Q

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156496
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Most mice homozygous for a gene trap mutation die at E10-E14.5 with severe neural tube defects manifest as midbrain/hindbrain exencephaly and/or spina bifida and associated with impaired autophagy, accumulation of ubiquitinated proteins, abnormal cell proliferation and excessive apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Ambra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ambra1 APN 2 91911589 missense probably benign 0.01
IGL00861:Ambra1 APN 2 91770926 missense possibly damaging 0.81
IGL00911:Ambra1 APN 2 91767682 splice site probably benign
IGL01371:Ambra1 APN 2 91825286 missense probably damaging 1.00
IGL01532:Ambra1 APN 2 91885632 missense probably damaging 1.00
IGL01620:Ambra1 APN 2 91911412 critical splice acceptor site probably null
IGL02147:Ambra1 APN 2 91767719 missense probably benign 0.01
IGL02170:Ambra1 APN 2 91767087 missense possibly damaging 0.66
IGL02173:Ambra1 APN 2 91917668 missense probably benign
IGL02212:Ambra1 APN 2 91917361 missense probably damaging 1.00
IGL02256:Ambra1 APN 2 91769054 missense possibly damaging 0.95
IGL02319:Ambra1 APN 2 91886920 missense probably damaging 1.00
IGL02502:Ambra1 APN 2 91900532 missense probably damaging 1.00
IGL02961:Ambra1 APN 2 91911448 missense possibly damaging 0.86
R0003:Ambra1 UTSW 2 91911428 missense probably damaging 1.00
R0098:Ambra1 UTSW 2 91767711 missense possibly damaging 0.66
R0173:Ambra1 UTSW 2 91810219 splice site probably benign
R0414:Ambra1 UTSW 2 91875739 missense possibly damaging 0.84
R0579:Ambra1 UTSW 2 91824465 missense possibly damaging 0.66
R1212:Ambra1 UTSW 2 91769036 missense possibly damaging 0.94
R1241:Ambra1 UTSW 2 91770896 splice site probably benign
R1467:Ambra1 UTSW 2 91885703 missense probably damaging 1.00
R1467:Ambra1 UTSW 2 91885703 missense probably damaging 1.00
R1533:Ambra1 UTSW 2 91886865 missense probably damaging 1.00
R1916:Ambra1 UTSW 2 91911461 missense probably damaging 1.00
R2080:Ambra1 UTSW 2 91885719 missense probably damaging 1.00
R2083:Ambra1 UTSW 2 91766600 missense possibly damaging 0.83
R2112:Ambra1 UTSW 2 91875787 missense probably damaging 1.00
R2255:Ambra1 UTSW 2 91917461 missense probably damaging 1.00
R3407:Ambra1 UTSW 2 91910307 missense probably damaging 1.00
R3732:Ambra1 UTSW 2 91810131 missense probably damaging 1.00
R4111:Ambra1 UTSW 2 91900558 missense probably damaging 1.00
R4792:Ambra1 UTSW 2 91772846 missense possibly damaging 0.66
R4879:Ambra1 UTSW 2 91772694 intron probably benign
R5007:Ambra1 UTSW 2 91772310 missense possibly damaging 0.79
R5261:Ambra1 UTSW 2 91885606 missense probably damaging 1.00
R6141:Ambra1 UTSW 2 91875754 missense probably damaging 1.00
R6413:Ambra1 UTSW 2 91769084 missense possibly damaging 0.92
R6868:Ambra1 UTSW 2 91917533 missense possibly damaging 0.83
R6888:Ambra1 UTSW 2 91769027 missense probably damaging 1.00
R6964:Ambra1 UTSW 2 91917416 nonsense probably null
R6970:Ambra1 UTSW 2 91772600 intron probably benign
R6982:Ambra1 UTSW 2 91917473 missense probably damaging 1.00
R7205:Ambra1 UTSW 2 91767758 missense possibly damaging 0.46
R7458:Ambra1 UTSW 2 91917684 missense probably benign 0.26
R7786:Ambra1 UTSW 2 91767796 missense possibly damaging 0.46
R7812:Ambra1 UTSW 2 91766566 start codon destroyed probably benign 0.00
R7825:Ambra1 UTSW 2 91767761 missense probably damaging 1.00
R7860:Ambra1 UTSW 2 91773493 missense probably benign 0.27
R8190:Ambra1 UTSW 2 91772352 missense possibly damaging 0.95
R8779:Ambra1 UTSW 2 91917374 missense probably benign 0.05
R9062:Ambra1 UTSW 2 91910317 missense possibly damaging 0.82
Z1177:Ambra1 UTSW 2 91768999 missense possibly damaging 0.81
Z1177:Ambra1 UTSW 2 91875786 missense probably damaging 0.97
Z1177:Ambra1 UTSW 2 91900608 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCAGGGTTGGCAACTGAGTC -3'
(R):5'- CCTCAAAGGTAGTGGAGACGTG -3'

Sequencing Primer
(F):5'- TTGGCAACTGAGTCAGATGG -3'
(R):5'- TGCCAGGAAGAGCTAGCCTC -3'
Posted On 2018-04-27