Mutagenetix > Incidental Mutation

Incidental Mutation 'R6364:Ambra1'

513380

Institutional Source

Beutler Lab

Gene Symbol

Ambra1

Ensembl Gene

ENSMUSG00000040506

Gene Name

autophagy/beclin 1 regulator 1

Synonyms

2310079H06Rik, D030051N19Rik

MMRRC Submission

044514-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.918) question?

Stock #

R6364 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91730134-91918849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 91773316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 548 (H548Q)

Ref Sequence

ENSEMBL: ENSMUSP00000106948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045699] [ENSMUST00000045705] [ENSMUST00000099712] [ENSMUST00000111316] [ENSMUST00000111317]

AlphaFold

A2AH22

Predicted Effect

probably benign
Transcript: ENSMUST00000045699
AA Change: H457Q

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000048898
Gene: ENSMUSG00000040506
AA Change: H457Q

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
low complexity region	636	643	N/A	INTRINSIC
Blast:WD40	812	850	1e-5	BLAST
Blast:WD40	871	918	1e-7	BLAST
low complexity region	942	954	N/A	INTRINSIC
low complexity region	1002	1026	N/A	INTRINSIC
low complexity region	1127	1143	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045705
AA Change: H548Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000049258
Gene: ENSMUSG00000040506
AA Change: H548Q

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	267	285	N/A	INTRINSIC
low complexity region	442	452	N/A	INTRINSIC
low complexity region	484	495	N/A	INTRINSIC
low complexity region	629	645	N/A	INTRINSIC
low complexity region	682	704	N/A	INTRINSIC
low complexity region	756	763	N/A	INTRINSIC
Blast:WD40	932	970	1e-5	BLAST
Blast:WD40	991	1038	1e-7	BLAST
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1122	1146	N/A	INTRINSIC
low complexity region	1247	1263	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099712
AA Change: H457Q

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000097299
Gene: ENSMUSG00000040506
AA Change: H457Q

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	613	N/A	INTRINSIC
low complexity region	665	672	N/A	INTRINSIC
Blast:WD40	841	879	1e-5	BLAST
Blast:WD40	900	947	1e-7	BLAST
low complexity region	971	983	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
low complexity region	1156	1172	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111316
AA Change: H548Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000106948
Gene: ENSMUSG00000040506
AA Change: H548Q

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	267	285	N/A	INTRINSIC
low complexity region	442	452	N/A	INTRINSIC
low complexity region	484	495	N/A	INTRINSIC
low complexity region	629	645	N/A	INTRINSIC
low complexity region	682	704	N/A	INTRINSIC
Blast:WD40	872	910	1e-5	BLAST
Blast:WD40	931	978	1e-7	BLAST
low complexity region	1002	1014	N/A	INTRINSIC
low complexity region	1062	1086	N/A	INTRINSIC
low complexity region	1187	1203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111317
AA Change: H457Q

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000106949
Gene: ENSMUSG00000040506
AA Change: H457Q

Domain	Start	End	E-Value	Type
WD40	50	81	4.11e1	SMART
WD40	84	124	1.16e-9	SMART
WD40	126	164	1.19e0	SMART
low complexity region	351	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
low complexity region	636	643	N/A	INTRINSIC
Blast:WD40	812	850	1e-5	BLAST
Blast:WD40	871	918	1e-7	BLAST
low complexity region	942	954	N/A	INTRINSIC
low complexity region	1002	1026	N/A	INTRINSIC
low complexity region	1127	1143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124132

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133490

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156496

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

99% (69/70)

MGI Phenotype

PHENOTYPE: Most mice homozygous for a gene trap mutation die at E10-E14.5 with severe neural tube defects manifest as midbrain/hindbrain exencephaly and/or spina bifida and associated with impaired autophagy, accumulation of ubiquitinated proteins, abnormal cell proliferation and excessive apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,721,814	Y234C	possibly damaging	Het
Als2cr12	G	T	1: 58,658,372	A403D	probably damaging	Het
Ap3d1	T	C	10: 80,710,494		probably null	Het
Apol11b	A	G	15: 77,638,058	V13A	possibly damaging	Het
Arhgdib	C	T	6: 136,932,255		probably null	Het
B3galt1	T	A	2: 68,118,672	S244T	probably damaging	Het
Bace2	A	G	16: 97,413,433	I274V	probably benign	Het
Bfsp2	A	T	9: 103,448,628	V272D	probably damaging	Het
Blm	A	T	7: 80,494,526	C782*	probably null	Het
Cfi	G	A	3: 129,872,846	S406N	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	A	7: 25,272,823	H660N	possibly damaging	Het
Cops3	A	G	11: 59,835,404		probably benign	Het
Dlec1	G	A	9: 119,121,871	V502I	possibly damaging	Het
Epop	A	G	11: 97,628,687	S199P	probably benign	Het
Evi5	G	T	5: 107,842,113	P80Q	probably damaging	Het
Faf1	T	C	4: 109,961,800	V623A	possibly damaging	Het
Fam129c	G	A	8: 71,599,089	G23S	probably benign	Het
Fam83c	T	C	2: 155,834,523	D109G	probably damaging	Het
Fam83d	T	C	2: 158,783,259		probably null	Het
Foxn3	T	C	12: 99,388,693	N71D	probably benign	Het
Gm7298	A	G	6: 121,779,443	R1016G	possibly damaging	Het
Grin2d	T	C	7: 45,858,454	E396G	possibly damaging	Het
Htra2	C	A	6: 83,053,046	V311F	probably damaging	Het
Kif6	A	T	17: 49,620,623	T33S	probably benign	Het
Kmt2c	T	C	5: 25,309,636	I3070V	probably null	Het
Krtap5-2	A	T	7: 142,175,063	C293*	probably null	Het
Lrp3	T	A	7: 35,203,709	D404V	probably benign	Het
Mc2r	T	G	18: 68,407,536	I229L	probably benign	Het
Mtnr1b	A	G	9: 15,863,004	M253T	possibly damaging	Het
Nfat5	A	G	8: 107,368,277	N531S	probably benign	Het
Npr2	T	A	4: 43,643,622	I550N	probably damaging	Het
Npy6r	T	C	18: 44,276,511	I333T	possibly damaging	Het
Nup88	C	T	11: 70,947,786	R468Q	probably benign	Het
Nup98	G	A	7: 102,176,315	T422I	probably damaging	Het
Olfr433	T	A	1: 174,042,212	H87Q	possibly damaging	Het
Oraov1	A	G	7: 144,919,268	D105G	probably benign	Het
Otud4	A	G	8: 79,646,341	N96S	probably damaging	Het
Paqr6	T	C	3: 88,365,958	F86L	probably damaging	Het
Ppp4r3b	A	T	11: 29,188,035	T90S	probably benign	Het
Ptbp2	A	T	3: 119,740,442	N23K	probably damaging	Het
Ralgapb	G	T	2: 158,462,109	G596V	probably damaging	Het
Rdm1	G	A	11: 101,630,242	R94H	probably benign	Het
Rergl	A	T	6: 139,500,748	F28I	probably damaging	Het
Rif1	G	T	2: 52,107,669	S1000I	probably damaging	Het
Rnf141	C	T	7: 110,821,309	A163T	possibly damaging	Het
Scaf4	G	A	16: 90,260,248	Q72*	probably null	Het
Sdk1	G	T	5: 141,962,709	S603I	probably benign	Het
Sdsl	T	C	5: 120,460,609	I147M	probably damaging	Het
Serpina6	T	C	12: 103,654,236	N85D	probably benign	Het
Serpinf2	A	G	11: 75,436,489	I204T	probably damaging	Het
Shank2	A	G	7: 144,410,409	S795G	probably benign	Het
Simc1	C	T	13: 54,524,600	Q254*	probably null	Het
Slc30a3	G	A	5: 31,088,739	P216S	possibly damaging	Het
Smim14	T	A	5: 65,453,296	I53F	probably benign	Het
Sp3	T	C	2: 72,970,941	T243A	probably benign	Het
Srpk2	A	G	5: 23,540,467	F164L	probably damaging	Het
Stard9	T	C	2: 120,713,429	F4403L	probably damaging	Het
Tbc1d30	T	C	10: 121,294,725	T267A	possibly damaging	Het
Tgm7	T	A	2: 121,096,397	R424*	probably null	Het
Tmbim6	T	C	15: 99,406,185	L113P	probably damaging	Het
Tmcc1	G	A	6: 116,043,761		probably benign	Het
Tomm7	A	G	5: 23,844,030	L15P	probably damaging	Het
Tpcn1	T	C	5: 120,553,810	Y263C	probably damaging	Het
Trim34b	T	C	7: 104,336,526	F456S	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r108	A	G	17: 20,470,998	I421T	probably benign	Het
Wdr43	A	G	17: 71,657,654	E676G	probably damaging	Het
Wdr60	A	T	12: 116,241,732	D412E	probably damaging	Het
Zcchc14	G	T	8: 121,604,859		probably benign	Het
Zfp64	C	A	2: 168,912,266	G25V	probably damaging	Het
Zswim8	C	A	14: 20,713,011	P326H	probably damaging	Het

Other mutations in Ambra1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Ambra1	APN	2	91911589	missense	probably benign	0.01
IGL00861:Ambra1	APN	2	91770926	missense	possibly damaging	0.81
IGL00911:Ambra1	APN	2	91767682	splice site	probably benign
IGL01371:Ambra1	APN	2	91825286	missense	probably damaging	1.00
IGL01532:Ambra1	APN	2	91885632	missense	probably damaging	1.00
IGL01620:Ambra1	APN	2	91911412	critical splice acceptor site	probably null
IGL02147:Ambra1	APN	2	91767719	missense	probably benign	0.01
IGL02170:Ambra1	APN	2	91767087	missense	possibly damaging	0.66
IGL02173:Ambra1	APN	2	91917668	missense	probably benign
IGL02212:Ambra1	APN	2	91917361	missense	probably damaging	1.00
IGL02256:Ambra1	APN	2	91769054	missense	possibly damaging	0.95
IGL02319:Ambra1	APN	2	91886920	missense	probably damaging	1.00
IGL02502:Ambra1	APN	2	91900532	missense	probably damaging	1.00
IGL02961:Ambra1	APN	2	91911448	missense	possibly damaging	0.86
R0003:Ambra1	UTSW	2	91911428	missense	probably damaging	1.00
R0098:Ambra1	UTSW	2	91767711	missense	possibly damaging	0.66
R0173:Ambra1	UTSW	2	91810219	splice site	probably benign
R0414:Ambra1	UTSW	2	91875739	missense	possibly damaging	0.84
R0579:Ambra1	UTSW	2	91824465	missense	possibly damaging	0.66
R1212:Ambra1	UTSW	2	91769036	missense	possibly damaging	0.94
R1241:Ambra1	UTSW	2	91770896	splice site	probably benign
R1467:Ambra1	UTSW	2	91885703	missense	probably damaging	1.00
R1467:Ambra1	UTSW	2	91885703	missense	probably damaging	1.00
R1533:Ambra1	UTSW	2	91886865	missense	probably damaging	1.00
R1916:Ambra1	UTSW	2	91911461	missense	probably damaging	1.00
R2080:Ambra1	UTSW	2	91885719	missense	probably damaging	1.00
R2083:Ambra1	UTSW	2	91766600	missense	possibly damaging	0.83
R2112:Ambra1	UTSW	2	91875787	missense	probably damaging	1.00
R2255:Ambra1	UTSW	2	91917461	missense	probably damaging	1.00
R3407:Ambra1	UTSW	2	91910307	missense	probably damaging	1.00
R3732:Ambra1	UTSW	2	91810131	missense	probably damaging	1.00
R4111:Ambra1	UTSW	2	91900558	missense	probably damaging	1.00
R4792:Ambra1	UTSW	2	91772846	missense	possibly damaging	0.66
R4879:Ambra1	UTSW	2	91772694	intron	probably benign
R5007:Ambra1	UTSW	2	91772310	missense	possibly damaging	0.79
R5261:Ambra1	UTSW	2	91885606	missense	probably damaging	1.00
R6141:Ambra1	UTSW	2	91875754	missense	probably damaging	1.00
R6413:Ambra1	UTSW	2	91769084	missense	possibly damaging	0.92
R6868:Ambra1	UTSW	2	91917533	missense	possibly damaging	0.83
R6888:Ambra1	UTSW	2	91769027	missense	probably damaging	1.00
R6964:Ambra1	UTSW	2	91917416	nonsense	probably null
R6970:Ambra1	UTSW	2	91772600	intron	probably benign
R6982:Ambra1	UTSW	2	91917473	missense	probably damaging	1.00
R7205:Ambra1	UTSW	2	91767758	missense	possibly damaging	0.46
R7458:Ambra1	UTSW	2	91917684	missense	probably benign	0.26
R7786:Ambra1	UTSW	2	91767796	missense	possibly damaging	0.46
R7812:Ambra1	UTSW	2	91766566	start codon destroyed	probably benign	0.00
R7825:Ambra1	UTSW	2	91767761	missense	probably damaging	1.00
R7860:Ambra1	UTSW	2	91773493	missense	probably benign	0.27
R8190:Ambra1	UTSW	2	91772352	missense	possibly damaging	0.95
R8779:Ambra1	UTSW	2	91917374	missense	probably benign	0.05
R9044:Ambra1	UTSW	2	91910089	intron	probably benign
R9062:Ambra1	UTSW	2	91910317	missense	possibly damaging	0.82
R9707:Ambra1	UTSW	2	91810131	missense	probably damaging	1.00
Z1177:Ambra1	UTSW	2	91768999	missense	possibly damaging	0.81
Z1177:Ambra1	UTSW	2	91875786	missense	probably damaging	0.97
Z1177:Ambra1	UTSW	2	91900608	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TCAGGGTTGGCAACTGAGTC -3'
(R):5'- CCTCAAAGGTAGTGGAGACGTG -3'

Sequencing Primer
(F):5'- TTGGCAACTGAGTCAGATGG -3'
(R):5'- TGCCAGGAAGAGCTAGCCTC -3'

Posted On

2018-04-27