Mutagenetix > Incidental Mutations

Incidental Mutation 'R6364:Stard9'

513381

Institutional Source

Beutler Lab

Gene Symbol

Stard9

Ensembl Gene

ENSMUSG00000033705

Gene Name

START domain containing 9

Synonyms

E230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R6364 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120629121-120731895 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120713429 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 4403 (F4403L)

Ref Sequence

ENSEMBL: ENSMUSP00000136055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000070420

SMART Domains

Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
coiled coil region	97	138	N/A	INTRINSIC
low complexity region	142	151	N/A	INTRINSIC
low complexity region	157	174	N/A	INTRINSIC
low complexity region	234	255	N/A	INTRINSIC
Pfam:START	274	469	3.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110700

SMART Domains

Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284

Domain	Start	End	E-Value	Type
low complexity region	25	42	N/A	INTRINSIC
low complexity region	78	99	N/A	INTRINSIC
low complexity region	102	151	N/A	INTRINSIC
low complexity region	154	180	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	786	906	2.4e-48	PFAM
low complexity region	1157	1171	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110701

SMART Domains

Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284

Domain	Start	End	E-Value	Type
low complexity region	77	98	N/A	INTRINSIC
low complexity region	101	150	N/A	INTRINSIC
low complexity region	153	179	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	789	904	2.4e-41	PFAM
low complexity region	1164	1178	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129384

Predicted Effect

probably benign
Transcript: ENSMUST00000140843

SMART Domains

Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
FHA	63	115	2.8e-4	SMART
coiled coil region	334	354	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	866	871	N/A	INTRINSIC
low complexity region	1023	1035	N/A	INTRINSIC
low complexity region	1234	1248	N/A	INTRINSIC
low complexity region	1765	1775	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2953	2963	N/A	INTRINSIC
low complexity region	3269	3281	N/A	INTRINSIC
low complexity region	3421	3435	N/A	INTRINSIC
coiled coil region	3767	3808	N/A	INTRINSIC
low complexity region	3812	3821	N/A	INTRINSIC
low complexity region	3827	3844	N/A	INTRINSIC
low complexity region	3904	3925	N/A	INTRINSIC
SCOP:d1jssa_	3946	4142	1e-28	SMART
Blast:START	3947	4143	1e-10	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141917

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148285

Predicted Effect

probably damaging
Transcript: ENSMUST00000154193
AA Change: F627L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705
AA Change: F627L

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
coiled coil region	409	450	N/A	INTRINSIC
low complexity region	454	463	N/A	INTRINSIC
low complexity region	469	486	N/A	INTRINSIC
low complexity region	546	567	N/A	INTRINSIC
SCOP:d1jssa_	588	784	4e-29	SMART
Blast:START	589	785	6e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000180041
AA Change: F4403L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: F4403L

Domain	Start	End	E-Value	Type
KISc	1	392	3.31e-143	SMART
low complexity region	398	409	N/A	INTRINSIC
FHA	481	533	2.8e-4	SMART
coiled coil region	752	772	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
low complexity region	1284	1289	N/A	INTRINSIC
low complexity region	1441	1453	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	2183	2193	N/A	INTRINSIC
low complexity region	2964	2977	N/A	INTRINSIC
low complexity region	3371	3381	N/A	INTRINSIC
low complexity region	3687	3699	N/A	INTRINSIC
low complexity region	3839	3853	N/A	INTRINSIC
coiled coil region	4185	4226	N/A	INTRINSIC
low complexity region	4230	4239	N/A	INTRINSIC
low complexity region	4245	4262	N/A	INTRINSIC
low complexity region	4322	4343	N/A	INTRINSIC

Meta Mutation Damage Score

0.1669

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

99% (69/70)

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,721,814	Y234C	possibly damaging	Het
Als2cr12	G	T	1: 58,658,372	A403D	probably damaging	Het
Ambra1	C	A	2: 91,773,316	H548Q	possibly damaging	Het
Ap3d1	T	C	10: 80,710,494		probably null	Het
Apol11b	A	G	15: 77,638,058	V13A	possibly damaging	Het
Arhgdib	C	T	6: 136,932,255		probably null	Het
B3galt1	T	A	2: 68,118,672	S244T	probably damaging	Het
Bace2	A	G	16: 97,413,433	I274V	probably benign	Het
Bfsp2	A	T	9: 103,448,628	V272D	probably damaging	Het
Blm	A	T	7: 80,494,526	C782*	probably null	Het
Cfi	G	A	3: 129,872,846	S406N	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	A	7: 25,272,823	H660N	possibly damaging	Het
Cops3	A	G	11: 59,835,404		probably benign	Het
Dlec1	G	A	9: 119,121,871	V502I	possibly damaging	Het
Epop	A	G	11: 97,628,687	S199P	probably benign	Het
Evi5	G	T	5: 107,842,113	P80Q	probably damaging	Het
Faf1	T	C	4: 109,961,800	V623A	possibly damaging	Het
Fam129c	G	A	8: 71,599,089	G23S	probably benign	Het
Fam83c	T	C	2: 155,834,523	D109G	probably damaging	Het
Fam83d	T	C	2: 158,783,259		probably null	Het
Foxn3	T	C	12: 99,388,693	N71D	probably benign	Het
Gm7298	A	G	6: 121,779,443	R1016G	possibly damaging	Het
Grin2d	T	C	7: 45,858,454	E396G	possibly damaging	Het
Htra2	C	A	6: 83,053,046	V311F	probably damaging	Het
Kif6	A	T	17: 49,620,623	T33S	probably benign	Het
Kmt2c	T	C	5: 25,309,636	I3070V	probably null	Het
Krtap5-2	A	T	7: 142,175,063	C293*	probably null	Het
Lrp3	T	A	7: 35,203,709	D404V	probably benign	Het
Mc2r	T	G	18: 68,407,536	I229L	probably benign	Het
Mtnr1b	A	G	9: 15,863,004	M253T	possibly damaging	Het
Nfat5	A	G	8: 107,368,277	N531S	probably benign	Het
Npr2	T	A	4: 43,643,622	I550N	probably damaging	Het
Npy6r	T	C	18: 44,276,511	I333T	possibly damaging	Het
Nup88	C	T	11: 70,947,786	R468Q	probably benign	Het
Nup98	G	A	7: 102,176,315	T422I	probably damaging	Het
Olfr433	T	A	1: 174,042,212	H87Q	possibly damaging	Het
Oraov1	A	G	7: 144,919,268	D105G	probably benign	Het
Otud4	A	G	8: 79,646,341	N96S	probably damaging	Het
Paqr6	T	C	3: 88,365,958	F86L	probably damaging	Het
Ppp4r3b	A	T	11: 29,188,035	T90S	probably benign	Het
Ptbp2	A	T	3: 119,740,442	N23K	probably damaging	Het
Ralgapb	G	T	2: 158,462,109	G596V	probably damaging	Het
Rdm1	G	A	11: 101,630,242	R94H	probably benign	Het
Rergl	A	T	6: 139,500,748	F28I	probably damaging	Het
Rif1	G	T	2: 52,107,669	S1000I	probably damaging	Het
Rnf141	C	T	7: 110,821,309	A163T	possibly damaging	Het
Scaf4	G	A	16: 90,260,248	Q72*	probably null	Het
Sdk1	G	T	5: 141,962,709	S603I	probably benign	Het
Sdsl	T	C	5: 120,460,609	I147M	probably damaging	Het
Serpina6	T	C	12: 103,654,236	N85D	probably benign	Het
Serpinf2	A	G	11: 75,436,489	I204T	probably damaging	Het
Shank2	A	G	7: 144,410,409	S795G	probably benign	Het
Simc1	C	T	13: 54,524,600	Q254*	probably null	Het
Slc30a3	G	A	5: 31,088,739	P216S	possibly damaging	Het
Smim14	T	A	5: 65,453,296	I53F	probably benign	Het
Sp3	T	C	2: 72,970,941	T243A	probably benign	Het
Srpk2	A	G	5: 23,540,467	F164L	probably damaging	Het
Tbc1d30	T	C	10: 121,294,725	T267A	possibly damaging	Het
Tgm7	T	A	2: 121,096,397	R424*	probably null	Het
Tmbim6	T	C	15: 99,406,185	L113P	probably damaging	Het
Tmcc1	G	A	6: 116,043,761		probably benign	Het
Tomm7	A	G	5: 23,844,030	L15P	probably damaging	Het
Tpcn1	T	C	5: 120,553,810	Y263C	probably damaging	Het
Trim34b	T	C	7: 104,336,526	F456S	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r108	A	G	17: 20,470,998	I421T	probably benign	Het
Wdr43	A	G	17: 71,657,654	E676G	probably damaging	Het
Wdr60	A	T	12: 116,241,732	D412E	probably damaging	Het
Zcchc14	G	T	8: 121,604,859		probably benign	Het
Zfp64	C	A	2: 168,912,266	G25V	probably damaging	Het
Zswim8	C	A	14: 20,713,011	P326H	probably damaging	Het

Other mutations in Stard9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Stard9	APN	2	120701847	missense	possibly damaging	0.52
IGL01122:Stard9	APN	2	120698479	missense	possibly damaging	0.93
IGL01318:Stard9	APN	2	120698719	missense	possibly damaging	0.56
IGL01371:Stard9	APN	2	120701368	missense	probably benign	0.04
IGL01394:Stard9	APN	2	120706327	missense	possibly damaging	0.78
IGL01531:Stard9	APN	2	120673604	missense	possibly damaging	0.93
IGL01721:Stard9	APN	2	120703330	missense	probably damaging	1.00
IGL01810:Stard9	APN	2	120699084	missense	possibly damaging	0.95
IGL01829:Stard9	APN	2	120706446	missense	possibly damaging	0.59
IGL01916:Stard9	APN	2	120668016	missense	probably damaging	1.00
IGL02031:Stard9	APN	2	120702339	missense	probably benign	0.27
IGL02081:Stard9	APN	2	120664910	missense	probably damaging	0.98
IGL02558:Stard9	APN	2	120696907	missense	possibly damaging	0.95
IGL02646:Stard9	APN	2	120698992	missense	probably damaging	1.00
IGL02873:Stard9	APN	2	120713807	missense	probably damaging	1.00
IGL03195:Stard9	APN	2	120705802	missense	probably damaging	1.00
IGL03204:Stard9	APN	2	120705802	missense	probably damaging	1.00
FR4737:Stard9	UTSW	2	120696085	small insertion	probably benign
IGL03014:Stard9	UTSW	2	120702194	unclassified	probably benign
PIT4151001:Stard9	UTSW	2	120702756	nonsense	probably null
PIT4498001:Stard9	UTSW	2	120697435	missense	possibly damaging	0.86
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0038:Stard9	UTSW	2	120695832	missense	probably benign
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0116:Stard9	UTSW	2	120634255	missense	probably damaging	0.99
R0398:Stard9	UTSW	2	120696307	missense	probably benign	0.03
R0479:Stard9	UTSW	2	120697596	missense	probably damaging	1.00
R0556:Stard9	UTSW	2	120698923	missense	probably benign	0.09
R0589:Stard9	UTSW	2	120698547	missense	probably benign	0.00
R0609:Stard9	UTSW	2	120706306	missense	probably damaging	1.00
R0611:Stard9	UTSW	2	120699257	missense	probably benign	0.00
R0683:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0751:Stard9	UTSW	2	120697485	missense	probably benign	0.04
R0833:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0836:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0838:Stard9	UTSW	2	120700842	missense	probably damaging	1.00
R0848:Stard9	UTSW	2	120695823	missense	probably damaging	1.00
R0849:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0961:Stard9	UTSW	2	120693439	missense	probably benign	0.01
R0993:Stard9	UTSW	2	120705169	missense	probably damaging	1.00
R1005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1006:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1115:Stard9	UTSW	2	120692850	missense	probably benign	0.05
R1163:Stard9	UTSW	2	120696213	missense	possibly damaging	0.86
R1199:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1200:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1331:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1332:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1333:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1334:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1335:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1336:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1338:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1346:Stard9	UTSW	2	120713448	missense	probably damaging	1.00
R1370:Stard9	UTSW	2	120697477	missense	probably benign	0.11
R1384:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1401:Stard9	UTSW	2	120712847	splice site	probably benign
R1416:Stard9	UTSW	2	120700972	missense	probably benign	0.00
R1453:Stard9	UTSW	2	120666376	missense	probably damaging	1.00
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1525:Stard9	UTSW	2	120702052	missense	probably benign	0.09
R1538:Stard9	UTSW	2	120696711	missense	probably benign	0.25
R1614:Stard9	UTSW	2	120697675	missense	possibly damaging	0.95
R1654:Stard9	UTSW	2	120703722	missense	probably benign	0.37
R1658:Stard9	UTSW	2	120701542	missense	probably benign	0.02
R1686:Stard9	UTSW	2	120699492	missense	probably benign	0.00
R1797:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1803:Stard9	UTSW	2	120701489	missense	probably benign	0.24
R1806:Stard9	UTSW	2	120679453	splice site	probably null
R1847:Stard9	UTSW	2	120698489	missense	possibly damaging	0.51
R1853:Stard9	UTSW	2	120688751	missense	probably damaging	1.00
R1892:Stard9	UTSW	2	120693708	missense	probably benign	0.01
R1906:Stard9	UTSW	2	120696427	missense	probably benign	0.00
R1907:Stard9	UTSW	2	120713812	missense	probably damaging	1.00
R1930:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1933:Stard9	UTSW	2	120698656	missense	possibly damaging	0.55
R1989:Stard9	UTSW	2	120701406	missense	probably benign
R1999:Stard9	UTSW	2	120692868	missense	probably damaging	0.99
R2004:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2005:Stard9	UTSW	2	120664945	missense	possibly damaging	0.90
R2005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2021:Stard9	UTSW	2	120704235	missense	probably benign	0.05
R2025:Stard9	UTSW	2	120702398	missense	probably benign	0.20
R2190:Stard9	UTSW	2	120714120	missense	probably benign	0.22
R2204:Stard9	UTSW	2	120698531	frame shift	probably null
R2422:Stard9	UTSW	2	120700284	missense	probably benign	0.29
R3401:Stard9	UTSW	2	120703689	missense	probably damaging	0.98
R3618:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3619:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3900:Stard9	UTSW	2	120713549	missense	possibly damaging	0.93
R3943:Stard9	UTSW	2	120698229	missense	probably benign	0.11
R4022:Stard9	UTSW	2	120704155	missense	probably benign	0.05
R4223:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4224:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4225:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4345:Stard9	UTSW	2	120701946	missense	probably benign	0.43
R4382:Stard9	UTSW	2	120634222	missense	probably damaging	1.00
R4453:Stard9	UTSW	2	120697791	missense	probably benign
R4499:Stard9	UTSW	2	120700241	missense	probably benign	0.05
R4524:Stard9	UTSW	2	120696445	missense	probably damaging	1.00
R4671:Stard9	UTSW	2	120698640	missense	probably damaging	0.98
R4701:Stard9	UTSW	2	120705713	missense	possibly damaging	0.85
R4744:Stard9	UTSW	2	120696123	missense	probably benign	0.01
R4822:Stard9	UTSW	2	120695941	missense	possibly damaging	0.94
R4847:Stard9	UTSW	2	120703113	missense	probably benign	0.18
R4863:Stard9	UTSW	2	120700860	missense	probably benign	0.00
R4898:Stard9	UTSW	2	120706419	nonsense	probably null
R5033:Stard9	UTSW	2	120693399	missense	probably benign	0.00
R5087:Stard9	UTSW	2	120697019	nonsense	probably null
R5157:Stard9	UTSW	2	120697861	missense	probably benign
R5213:Stard9	UTSW	2	120699226	missense	probably damaging	1.00
R5237:Stard9	UTSW	2	120699358	missense	probably damaging	0.96
R5257:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5258:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5273:Stard9	UTSW	2	120705087	missense	possibly damaging	0.94
R5286:Stard9	UTSW	2	120701947	missense	probably benign	0.43
R5288:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5292:Stard9	UTSW	2	120699145	missense	probably benign	0.17
R5328:Stard9	UTSW	2	120699230	missense	probably damaging	1.00
R5385:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5386:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5393:Stard9	UTSW	2	120702906	missense	possibly damaging	0.87
R5405:Stard9	UTSW	2	120693668	missense	probably benign	0.17
R5685:Stard9	UTSW	2	120705322	missense	probably damaging	1.00
R5749:Stard9	UTSW	2	120703786	missense	probably damaging	1.00
R5780:Stard9	UTSW	2	120703396	missense	probably benign	0.02
R5901:Stard9	UTSW	2	120701370	missense	probably damaging	1.00
R5941:Stard9	UTSW	2	120713558	missense	probably damaging	1.00
R5960:Stard9	UTSW	2	120699961	missense	probably benign	0.05
R5966:Stard9	UTSW	2	120697099	missense	probably damaging	1.00
R5967:Stard9	UTSW	2	120706894	missense	probably damaging	0.99
R6012:Stard9	UTSW	2	120704586	missense	probably damaging	1.00
R6019:Stard9	UTSW	2	120693715	frame shift	probably null
R6020:Stard9	UTSW	2	120693715	frame shift	probably null
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6090:Stard9	UTSW	2	120693654	missense	probably damaging	0.99
R6192:Stard9	UTSW	2	120696760	missense	probably damaging	0.99
R6228:Stard9	UTSW	2	120713750	missense	probably damaging	1.00
R6235:Stard9	UTSW	2	120713546	missense	probably damaging	1.00
R6280:Stard9	UTSW	2	120701127	missense	probably benign
R6338:Stard9	UTSW	2	120697485	missense	probably benign
R6344:Stard9	UTSW	2	120704320	missense	probably benign	0.12
R6383:Stard9	UTSW	2	120666407	critical splice donor site	probably null
R6644:Stard9	UTSW	2	120695772	missense	probably benign	0.11
R6747:Stard9	UTSW	2	120698383	missense	possibly damaging	0.62
R6833:Stard9	UTSW	2	120701259	missense	probably damaging	1.00
R6836:Stard9	UTSW	2	120699843	missense	probably benign	0.15
R6861:Stard9	UTSW	2	120705186	missense	probably benign	0.09
R6872:Stard9	UTSW	2	120714068	nonsense	probably null
R6875:Stard9	UTSW	2	120697436	missense	probably benign	0.04
R6915:Stard9	UTSW	2	120702630	missense	probably benign	0.00
R6934:Stard9	UTSW	2	120697695	missense	probably benign	0.00
R6943:Stard9	UTSW	2	120702196	missense	probably benign	0.29
R7009:Stard9	UTSW	2	120697191	missense	probably benign	0.37
R7031:Stard9	UTSW	2	120700450	missense	possibly damaging	0.61
R7132:Stard9	UTSW	2	120679378	nonsense	probably null
R7151:Stard9	UTSW	2	120696142	missense	probably benign
R7154:Stard9	UTSW	2	120701314	missense	probably benign	0.00
R7154:Stard9	UTSW	2	120704542	missense	probably benign	0.02
R7165:Stard9	UTSW	2	120704158	missense	probably damaging	1.00
R7260:Stard9	UTSW	2	120706938	missense	possibly damaging	0.90
R7270:Stard9	UTSW	2	120634274	nonsense	probably null
R7282:Stard9	UTSW	2	120698503	missense	probably benign	0.00
R7344:Stard9	UTSW	2	120704686	missense	possibly damaging	0.90
R7347:Stard9	UTSW	2	120666534	missense	probably benign
R7359:Stard9	UTSW	2	120698280	missense	probably damaging	1.00
R7375:Stard9	UTSW	2	120665002	splice site	probably null
R7410:Stard9	UTSW	2	120701497	missense	probably benign	0.41
R7422:Stard9	UTSW	2	120702152	missense	probably benign	0.21
R7475:Stard9	UTSW	2	120688110	missense	probably damaging	1.00
R7523:Stard9	UTSW	2	120699597	missense	probably benign
R7553:Stard9	UTSW	2	120693808	splice site	probably null
R7624:Stard9	UTSW	2	120688146	missense	probably benign	0.15
R7761:Stard9	UTSW	2	120699379	missense	probably benign	0.00
R7794:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R7819:Stard9	UTSW	2	120700984	missense	probably damaging	1.00
R7823:Stard9	UTSW	2	120702106	missense	probably damaging	0.96
R7837:Stard9	UTSW	2	120703665	missense	probably benign	0.06
R7889:Stard9	UTSW	2	120704461	missense	probably benign	0.11
R7905:Stard9	UTSW	2	120696081	missense	not run
R7956:Stard9	UTSW	2	120705371	nonsense	probably null
R8013:Stard9	UTSW	2	120688101	missense	probably damaging	1.00
R8113:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8114:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8116:Stard9	UTSW	2	120664939	nonsense	probably null
R8117:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8118:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8170:Stard9	UTSW	2	120700048	missense	possibly damaging	0.76
R8300:Stard9	UTSW	2	120704769	missense	possibly damaging	0.71
R8333:Stard9	UTSW	2	120701789	missense	probably benign	0.00
R8337:Stard9	UTSW	2	120679825	missense	probably damaging	1.00
R8536:Stard9	UTSW	2	120714659	missense	possibly damaging	0.93
R8682:Stard9	UTSW	2	120703315	missense	possibly damaging	0.65
R8696:Stard9	UTSW	2	120701114	missense	probably benign	0.02
R8708:Stard9	UTSW	2	120703578	missense	probably damaging	1.00
R8732:Stard9	UTSW	2	120679961	missense	probably damaging	1.00
R8798:Stard9	UTSW	2	120704731	missense	probably benign	0.09
R8807:Stard9	UTSW	2	120705451	missense	probably damaging	1.00
R8807:Stard9	UTSW	2	120705462	missense	probably damaging	1.00
R8862:Stard9	UTSW	2	120703618	missense	probably benign
R8920:Stard9	UTSW	2	120702607	missense	probably damaging	0.96
R9026:Stard9	UTSW	2	120705802	missense	probably damaging	1.00
R9048:Stard9	UTSW	2	120677934	missense	probably damaging	0.99
R9049:Stard9	UTSW	2	120679937	missense	probably benign	0.30
R9152:Stard9	UTSW	2	120698587	missense	probably damaging	0.99
R9189:Stard9	UTSW	2	120703019	missense	possibly damaging	0.95
R9238:Stard9	UTSW	2	120697966	missense	probably damaging	1.00
R9372:Stard9	UTSW	2	120664939	nonsense	probably null
R9393:Stard9	UTSW	2	120688175	missense	possibly damaging	0.88
X0023:Stard9	UTSW	2	120702744	missense	probably benign	0.00
X0023:Stard9	UTSW	2	120702963	missense	possibly damaging	0.92
Z1176:Stard9	UTSW	2	120695818	missense	probably benign	0.01
Z1176:Stard9	UTSW	2	120696612	missense	probably benign
Z1176:Stard9	UTSW	2	120698322	missense	probably damaging	1.00
Z1177:Stard9	UTSW	2	120673676	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TAAGTTATTTTGCCGCCATGC -3'
(R):5'- ACAGTGCTGCTTTGACCTTC -3'

Sequencing Primer
(F):5'- ATGCTTTGGTCCTTCTGCATTATTC -3'
(R):5'- TTGACTCCCTGCCAGGC -3'

Posted On

2018-04-27