Incidental Mutation 'R6364:Tgm7'
ID513382
Institutional Source Beutler Lab
Gene Symbol Tgm7
Ensembl Gene ENSMUSG00000079103
Gene Nametransglutaminase 7
SynonymsTGz
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6364 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121093565-121109795 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 121096397 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 424 (R424*)
Ref Sequence ENSEMBL: ENSMUSP00000106303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110675]
Predicted Effect probably null
Transcript: ENSMUST00000110675
AA Change: R424*
SMART Domains Protein: ENSMUSP00000106303
Gene: ENSMUSG00000079103
AA Change: R424*

DomainStartEndE-ValueType
TGc 177 270 2.54e-42 SMART
SCOP:d1kv3a2 395 512 1e-33 SMART
Pfam:Transglut_C 514 612 1.7e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases (TGM; EC 2.3.2.13) are a family of structurally and functionally related enzymes that stabilize protein assemblies through the formation of gamma-glutamyl-epsilon lysine crosslinks. For additional background information on transglutaminases, see TGM1 (MIM 190195).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Tgm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Tgm7 APN 2 121106915 missense probably benign 0.16
IGL01576:Tgm7 APN 2 121101033 missense probably damaging 1.00
IGL01982:Tgm7 APN 2 121093625 nonsense probably null
IGL02077:Tgm7 APN 2 121103835 missense probably damaging 1.00
IGL02135:Tgm7 APN 2 121099038 missense possibly damaging 0.75
R0063:Tgm7 UTSW 2 121094096 missense probably benign 0.01
R0412:Tgm7 UTSW 2 121101065 missense probably damaging 1.00
R1869:Tgm7 UTSW 2 121101089 missense probably damaging 1.00
R2201:Tgm7 UTSW 2 121098581 missense probably damaging 1.00
R2276:Tgm7 UTSW 2 121098564 missense probably damaging 1.00
R2279:Tgm7 UTSW 2 121098564 missense probably damaging 1.00
R2872:Tgm7 UTSW 2 121109693 start gained probably benign
R2872:Tgm7 UTSW 2 121109693 start gained probably benign
R4523:Tgm7 UTSW 2 121098588 critical splice acceptor site probably null
R4688:Tgm7 UTSW 2 121094021 missense probably benign 0.06
R4757:Tgm7 UTSW 2 121096389 missense possibly damaging 0.75
R4858:Tgm7 UTSW 2 121098964 critical splice donor site probably null
R5132:Tgm7 UTSW 2 121104219 missense probably damaging 1.00
R5141:Tgm7 UTSW 2 121100999 missense probably benign 0.05
R5424:Tgm7 UTSW 2 121099041 missense probably damaging 1.00
R5911:Tgm7 UTSW 2 121095973 missense probably benign 0.27
R6166:Tgm7 UTSW 2 121099058 missense probably damaging 1.00
R6636:Tgm7 UTSW 2 121101090 missense probably damaging 1.00
R6637:Tgm7 UTSW 2 121101090 missense probably damaging 1.00
R6950:Tgm7 UTSW 2 121093647 missense probably damaging 1.00
R7094:Tgm7 UTSW 2 121099008 missense probably damaging 1.00
R7536:Tgm7 UTSW 2 121096397 nonsense probably null
R7729:Tgm7 UTSW 2 121093710 missense probably benign
R7822:Tgm7 UTSW 2 121103940 missense probably benign
R8213:Tgm7 UTSW 2 121101064 missense probably damaging 0.99
R8511:Tgm7 UTSW 2 121093660 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTCGTCTAATTCACAGACCC -3'
(R):5'- TTCTACCAGGATCCTCTGAGG -3'

Sequencing Primer
(F):5'- CAAAGCTCCCCCTTTACAGGTG -3'
(R):5'- CGGTCTGCATTCATTAAGGC -3'
Posted On2018-04-27