Incidental Mutation 'R6364:Ptbp2'
ID 513389
Institutional Source Beutler Lab
Gene Symbol Ptbp2
Ensembl Gene ENSMUSG00000028134
Gene Name polypyrimidine tract binding protein 2
Synonyms brPTB
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6364 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 119718742-119784466 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119740442 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 23 (N23K)
Ref Sequence ENSEMBL: ENSMUSP00000143325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029780] [ENSMUST00000195902] [ENSMUST00000197833] [ENSMUST00000200097]
AlphaFold Q91Z31
Predicted Effect probably benign
Transcript: ENSMUST00000029780
AA Change: N259K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029780
Gene: ENSMUSG00000028134
AA Change: N259K

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 1.22e-4 SMART
low complexity region 285 295 N/A INTRINSIC
RRM 339 408 1.07e-9 SMART
RRM 456 526 1.99e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195902
AA Change: N23K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143325
Gene: ENSMUSG00000028134
AA Change: N23K

DomainStartEndE-ValueType
Blast:RRM_2 1 48 7e-25 BLAST
PDB:1SJR|A 1 48 3e-27 PDB
low complexity region 49 59 N/A INTRINSIC
Pfam:RRM_1 109 154 1.9e-4 PFAM
Pfam:RRM_6 109 155 1.4e-6 PFAM
Pfam:RRM_5 124 155 2.6e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196343
Predicted Effect possibly damaging
Transcript: ENSMUST00000197833
AA Change: N259K

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143719
Gene: ENSMUSG00000028134
AA Change: N259K

DomainStartEndE-ValueType
RRM 60 129 1.7e-8 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 5.2e-7 SMART
low complexity region 285 295 N/A INTRINSIC
PDB:2MJU|A 325 349 4e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199417
Predicted Effect probably benign
Transcript: ENSMUST00000200097
AA Change: N259K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143510
Gene: ENSMUSG00000028134
AA Change: N259K

DomainStartEndE-ValueType
RRM 60 129 3.8e-6 SMART
low complexity region 144 159 N/A INTRINSIC
RRM 182 251 1.22e-4 SMART
low complexity region 285 295 N/A INTRINSIC
RRM 339 408 1.07e-9 SMART
RRM 456 525 8.08e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to intronic polypyrimidine clusters in pre-mRNA molecules and is implicated in controlling the assembly of other splicing-regulatory proteins. This protein is very similar to the polypyrimidine tract binding protein (PTB) but most of its isoforms are expressed primarily in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality with premature neurogenesis and abnormal neural stem cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Ptbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Ptbp2 APN 3 119747812 missense probably damaging 1.00
IGL01874:Ptbp2 APN 3 119747800 missense probably damaging 1.00
IGL01940:Ptbp2 APN 3 119726115 missense possibly damaging 0.46
IGL02094:Ptbp2 APN 3 119752940 splice site probably benign
IGL02374:Ptbp2 APN 3 119720693 splice site probably benign
IGL02523:Ptbp2 APN 3 119740487 nonsense probably null
IGL02879:Ptbp2 APN 3 119740405 missense probably damaging 1.00
IGL03149:Ptbp2 APN 3 119720425 missense possibly damaging 0.86
IGL03153:Ptbp2 APN 3 119751944 missense probably benign 0.04
IGL03391:Ptbp2 APN 3 119720382 nonsense probably null
R0067:Ptbp2 UTSW 3 119720641 missense probably benign 0.00
R0067:Ptbp2 UTSW 3 119720641 missense probably benign 0.00
R0091:Ptbp2 UTSW 3 119720661 missense probably damaging 1.00
R0396:Ptbp2 UTSW 3 119724198 splice site probably benign
R0511:Ptbp2 UTSW 3 119720964 missense probably benign
R0722:Ptbp2 UTSW 3 119720921 missense possibly damaging 0.72
R1573:Ptbp2 UTSW 3 119753105 missense probably damaging 1.00
R1907:Ptbp2 UTSW 3 119761749 missense probably damaging 1.00
R3606:Ptbp2 UTSW 3 119747632 missense probably damaging 1.00
R5082:Ptbp2 UTSW 3 119752964 missense probably benign 0.06
R5575:Ptbp2 UTSW 3 119720783 splice site probably null
R5575:Ptbp2 UTSW 3 119720789 missense possibly damaging 0.86
R5655:Ptbp2 UTSW 3 119724157 missense probably benign 0.44
R5836:Ptbp2 UTSW 3 119726097 missense probably damaging 0.98
R6290:Ptbp2 UTSW 3 119724120 missense possibly damaging 0.50
R6398:Ptbp2 UTSW 3 119720835 missense probably benign 0.23
R6574:Ptbp2 UTSW 3 119747947 missense probably damaging 0.99
R7037:Ptbp2 UTSW 3 119751908 missense probably damaging 1.00
R7243:Ptbp2 UTSW 3 119753112 missense possibly damaging 0.47
R7718:Ptbp2 UTSW 3 119720988 missense probably null 1.00
R8182:Ptbp2 UTSW 3 119740429 missense probably damaging 0.99
R8443:Ptbp2 UTSW 3 119747818 missense probably damaging 1.00
R9110:Ptbp2 UTSW 3 119747609 missense possibly damaging 0.69
R9164:Ptbp2 UTSW 3 119752991 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCCCAGAGAGCAATGGAGG -3'
(R):5'- CCATTAGGGCTGACTGTGTG -3'

Sequencing Primer
(F):5'- GAAAGGTGCTACAGACAGTAAAAGTC -3'
(R):5'- CTACTTAAGGAAGGCAGTGAGTG -3'
Posted On 2018-04-27