Incidental Mutation 'R6364:Npr2'
ID 513392
Institutional Source Beutler Lab
Gene Symbol Npr2
Ensembl Gene ENSMUSG00000028469
Gene Name natriuretic peptide receptor 2
Synonyms pwe, cn, guanylyl cyclase-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.866) question?
Stock # R6364 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 43631935-43651244 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43643622 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 550 (I550N)
Ref Sequence ENSEMBL: ENSMUSP00000103506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000107874]
AlphaFold Q6VVW5
Predicted Effect probably damaging
Transcript: ENSMUST00000030191
AA Change: I550N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469
AA Change: I550N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107874
AA Change: I550N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469
AA Change: I550N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123351
AA Change: I96N
SMART Domains Protein: ENSMUSP00000117761
Gene: ENSMUSG00000028469
AA Change: I96N

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 71 173 1.3e-12 PFAM
Pfam:Pkinase 85 170 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123883
Predicted Effect unknown
Transcript: ENSMUST00000128549
AA Change: I115N
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469
AA Change: I115N

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151603
Meta Mutation Damage Score 0.9481 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes natriuretic peptide receptor B, one of two integral membrane receptors for natriuretic peptides. Both NPR1 and NPR2 contain five functional domains: an extracellular ligand-binding domain, a single membrane-spanning region, and intracellularly a protein kinase homology domain, a helical hinge region involved in oligomerization, and a carboxyl-terminal guanylyl cyclase catalytic domain. The protein is the primary receptor for C-type natriuretic peptide (CNP), which upon ligand binding exhibits greatly increased guanylyl cyclase activity. Mutations in this gene are the cause of acromesomelic dysplasia Maroteaux type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in skeletal abnormalities, malocclusion, and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Npr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Npr2 APN 4 43641612 missense possibly damaging 0.51
IGL01116:Npr2 APN 4 43640248 missense probably damaging 0.99
IGL01447:Npr2 APN 4 43640554 missense possibly damaging 0.93
IGL02412:Npr2 APN 4 43647005 missense probably damaging 0.97
IGL02449:Npr2 APN 4 43646641 missense probably damaging 1.00
IGL03120:Npr2 APN 4 43643133 missense probably damaging 0.99
IGL03351:Npr2 APN 4 43640652 missense probably benign 0.36
Anterior UTSW 4 43643622 missense probably damaging 1.00
palmer UTSW 4 43647553 missense probably damaging 1.00
Plantar UTSW 4 43640597 missense probably damaging 1.00
Ventral UTSW 4 43641254 missense probably damaging 1.00
R0066:Npr2 UTSW 4 43632329 missense probably benign 0.00
R0201:Npr2 UTSW 4 43641617 missense probably damaging 0.98
R0309:Npr2 UTSW 4 43640904 unclassified probably benign
R0437:Npr2 UTSW 4 43648082 missense probably damaging 1.00
R0440:Npr2 UTSW 4 43650315 missense probably damaging 0.99
R0464:Npr2 UTSW 4 43640597 splice site probably null
R0511:Npr2 UTSW 4 43632801 missense probably benign 0.00
R0576:Npr2 UTSW 4 43640947 missense probably benign 0.01
R0630:Npr2 UTSW 4 43641219 missense probably benign 0.18
R0690:Npr2 UTSW 4 43646991 missense probably damaging 0.98
R1079:Npr2 UTSW 4 43643654 missense probably damaging 1.00
R1140:Npr2 UTSW 4 43648353 missense possibly damaging 0.87
R1171:Npr2 UTSW 4 43647260 missense possibly damaging 0.52
R1741:Npr2 UTSW 4 43643350 missense probably damaging 1.00
R1848:Npr2 UTSW 4 43632384 missense probably benign
R1864:Npr2 UTSW 4 43641258 missense probably benign 0.30
R1919:Npr2 UTSW 4 43640578 missense probably damaging 1.00
R2054:Npr2 UTSW 4 43646560 missense probably damaging 0.99
R2106:Npr2 UTSW 4 43644329 missense probably damaging 1.00
R2143:Npr2 UTSW 4 43648166 missense probably damaging 1.00
R2306:Npr2 UTSW 4 43633609 missense probably damaging 1.00
R2372:Npr2 UTSW 4 43650432 missense probably damaging 1.00
R2889:Npr2 UTSW 4 43641600 missense probably benign 0.26
R3076:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3078:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3711:Npr2 UTSW 4 43643378 missense probably benign 0.00
R3730:Npr2 UTSW 4 43640999 missense possibly damaging 0.93
R4301:Npr2 UTSW 4 43641332 critical splice donor site probably null
R4352:Npr2 UTSW 4 43646592 missense probably damaging 1.00
R4412:Npr2 UTSW 4 43644150 missense probably damaging 0.99
R4583:Npr2 UTSW 4 43633522 splice site probably null
R4593:Npr2 UTSW 4 43647323 unclassified probably benign
R5042:Npr2 UTSW 4 43647002 missense probably damaging 1.00
R5213:Npr2 UTSW 4 43640673 critical splice donor site probably null
R5546:Npr2 UTSW 4 43650150 missense probably damaging 1.00
R5784:Npr2 UTSW 4 43632801 missense probably benign 0.00
R5787:Npr2 UTSW 4 43633593 missense possibly damaging 0.69
R6925:Npr2 UTSW 4 43647553 missense probably damaging 1.00
R6949:Npr2 UTSW 4 43640597 missense probably damaging 1.00
R7380:Npr2 UTSW 4 43641254 missense probably damaging 1.00
R7432:Npr2 UTSW 4 43647155 missense probably damaging 0.96
R7500:Npr2 UTSW 4 43650415 missense probably damaging 1.00
R8235:Npr2 UTSW 4 43641603 missense probably benign 0.09
R8292:Npr2 UTSW 4 43643086 missense possibly damaging 0.70
R9310:Npr2 UTSW 4 43632404 missense probably benign 0.01
Z1176:Npr2 UTSW 4 43650720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCAACACCGGTCACTTC -3'
(R):5'- CTGGGAATCAGTGATAAATAAGCCC -3'

Sequencing Primer
(F):5'- ACACCGGTCACTTCAAGGTG -3'
(R):5'- CCTTATCCCGTTAGCCAGGGAAC -3'
Posted On 2018-04-27