Mutagenetix > Incidental Mutations

Incidental Mutation 'R6364:Tpcn1'

513402

Institutional Source

Beutler Lab

Gene Symbol

Tpcn1

Ensembl Gene

ENSMUSG00000032741

Gene Name

two pore channel 1

Synonyms

5730403B01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6364 (G1)

Quality Score

207.009

Status

Validated

Chromosome

Chromosomal Location

120534153-120588673 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120553810 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 263 (Y263C)

Ref Sequence

ENSEMBL: ENSMUSP00000042188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046426]

AlphaFold

Q9EQJ0

Predicted Effect

probably damaging
Transcript: ENSMUST00000046426
AA Change: Y263C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: Y263C

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	106	332	1.5e-30	PFAM
Pfam:Ion_trans	441	695	1.2e-31	PFAM
SCOP:d1fxkc_	713	795	2e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200708

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201971

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,721,814	Y234C	possibly damaging	Het
Als2cr12	G	T	1: 58,658,372	A403D	probably damaging	Het
Ambra1	C	A	2: 91,773,316	H548Q	possibly damaging	Het
Ap3d1	T	C	10: 80,710,494		probably null	Het
Apol11b	A	G	15: 77,638,058	V13A	possibly damaging	Het
Arhgdib	C	T	6: 136,932,255		probably null	Het
B3galt1	T	A	2: 68,118,672	S244T	probably damaging	Het
Bace2	A	G	16: 97,413,433	I274V	probably benign	Het
Bfsp2	A	T	9: 103,448,628	V272D	probably damaging	Het
Blm	A	T	7: 80,494,526	C782*	probably null	Het
Cfi	G	A	3: 129,872,846	S406N	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	A	7: 25,272,823	H660N	possibly damaging	Het
Cops3	A	G	11: 59,835,404		probably benign	Het
Dlec1	G	A	9: 119,121,871	V502I	possibly damaging	Het
Epop	A	G	11: 97,628,687	S199P	probably benign	Het
Evi5	G	T	5: 107,842,113	P80Q	probably damaging	Het
Faf1	T	C	4: 109,961,800	V623A	possibly damaging	Het
Fam129c	G	A	8: 71,599,089	G23S	probably benign	Het
Fam83c	T	C	2: 155,834,523	D109G	probably damaging	Het
Fam83d	T	C	2: 158,783,259		probably null	Het
Foxn3	T	C	12: 99,388,693	N71D	probably benign	Het
Gm7298	A	G	6: 121,779,443	R1016G	possibly damaging	Het
Grin2d	T	C	7: 45,858,454	E396G	possibly damaging	Het
Htra2	C	A	6: 83,053,046	V311F	probably damaging	Het
Kif6	A	T	17: 49,620,623	T33S	probably benign	Het
Kmt2c	T	C	5: 25,309,636	I3070V	probably null	Het
Krtap5-2	A	T	7: 142,175,063	C293*	probably null	Het
Lrp3	T	A	7: 35,203,709	D404V	probably benign	Het
Mc2r	T	G	18: 68,407,536	I229L	probably benign	Het
Mtnr1b	A	G	9: 15,863,004	M253T	possibly damaging	Het
Nfat5	A	G	8: 107,368,277	N531S	probably benign	Het
Npr2	T	A	4: 43,643,622	I550N	probably damaging	Het
Npy6r	T	C	18: 44,276,511	I333T	possibly damaging	Het
Nup88	C	T	11: 70,947,786	R468Q	probably benign	Het
Nup98	G	A	7: 102,176,315	T422I	probably damaging	Het
Olfr433	T	A	1: 174,042,212	H87Q	possibly damaging	Het
Oraov1	A	G	7: 144,919,268	D105G	probably benign	Het
Otud4	A	G	8: 79,646,341	N96S	probably damaging	Het
Paqr6	T	C	3: 88,365,958	F86L	probably damaging	Het
Ppp4r3b	A	T	11: 29,188,035	T90S	probably benign	Het
Ptbp2	A	T	3: 119,740,442	N23K	probably damaging	Het
Ralgapb	G	T	2: 158,462,109	G596V	probably damaging	Het
Rdm1	G	A	11: 101,630,242	R94H	probably benign	Het
Rergl	A	T	6: 139,500,748	F28I	probably damaging	Het
Rif1	G	T	2: 52,107,669	S1000I	probably damaging	Het
Rnf141	C	T	7: 110,821,309	A163T	possibly damaging	Het
Scaf4	G	A	16: 90,260,248	Q72*	probably null	Het
Sdk1	G	T	5: 141,962,709	S603I	probably benign	Het
Sdsl	T	C	5: 120,460,609	I147M	probably damaging	Het
Serpina6	T	C	12: 103,654,236	N85D	probably benign	Het
Serpinf2	A	G	11: 75,436,489	I204T	probably damaging	Het
Shank2	A	G	7: 144,410,409	S795G	probably benign	Het
Simc1	C	T	13: 54,524,600	Q254*	probably null	Het
Slc30a3	G	A	5: 31,088,739	P216S	possibly damaging	Het
Smim14	T	A	5: 65,453,296	I53F	probably benign	Het
Sp3	T	C	2: 72,970,941	T243A	probably benign	Het
Srpk2	A	G	5: 23,540,467	F164L	probably damaging	Het
Stard9	T	C	2: 120,713,429	F4403L	probably damaging	Het
Tbc1d30	T	C	10: 121,294,725	T267A	possibly damaging	Het
Tgm7	T	A	2: 121,096,397	R424*	probably null	Het
Tmbim6	T	C	15: 99,406,185	L113P	probably damaging	Het
Tmcc1	G	A	6: 116,043,761		probably benign	Het
Tomm7	A	G	5: 23,844,030	L15P	probably damaging	Het
Trim34b	T	C	7: 104,336,526	F456S	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r108	A	G	17: 20,470,998	I421T	probably benign	Het
Wdr43	A	G	17: 71,657,654	E676G	probably damaging	Het
Wdr60	A	T	12: 116,241,732	D412E	probably damaging	Het
Zcchc14	G	T	8: 121,604,859		probably benign	Het
Zfp64	C	A	2: 168,912,266	G25V	probably damaging	Het
Zswim8	C	A	14: 20,713,011	P326H	probably damaging	Het

Other mutations in Tpcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Tpcn1	APN	5	120545305	missense	probably damaging	0.99
IGL00551:Tpcn1	APN	5	120560325	missense	probably benign	0.31
IGL02197:Tpcn1	APN	5	120553531	missense	probably damaging	1.00
IGL02584:Tpcn1	APN	5	120539032	missense	probably damaging	0.99
IGL03064:Tpcn1	APN	5	120537566	missense	possibly damaging	0.90
PIT1430001:Tpcn1	UTSW	5	120548323	splice site	probably benign
R0295:Tpcn1	UTSW	5	120539060	missense	probably damaging	1.00
R0316:Tpcn1	UTSW	5	120539259	missense	probably damaging	1.00
R1577:Tpcn1	UTSW	5	120544420	missense	probably damaging	1.00
R1660:Tpcn1	UTSW	5	120549515	missense	possibly damaging	0.82
R1819:Tpcn1	UTSW	5	120536227	splice site	probably null
R2051:Tpcn1	UTSW	5	120543388	missense	probably damaging	1.00
R2364:Tpcn1	UTSW	5	120553494	nonsense	probably null
R2497:Tpcn1	UTSW	5	120538998	splice site	probably null
R3965:Tpcn1	UTSW	5	120556575	missense	probably damaging	0.98
R3972:Tpcn1	UTSW	5	120553752	critical splice donor site	probably null
R4062:Tpcn1	UTSW	5	120557897	missense	possibly damaging	0.82
R4343:Tpcn1	UTSW	5	120560220	missense	probably damaging	1.00
R4422:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4423:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4424:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4655:Tpcn1	UTSW	5	120539257	missense	probably damaging	0.98
R4831:Tpcn1	UTSW	5	120553489	missense	probably damaging	1.00
R4910:Tpcn1	UTSW	5	120556519	missense	probably damaging	0.98
R4948:Tpcn1	UTSW	5	120556531	missense	probably benign	0.15
R4965:Tpcn1	UTSW	5	120547487	missense	possibly damaging	0.82
R4976:Tpcn1	UTSW	5	120560322	missense	probably benign
R5071:Tpcn1	UTSW	5	120548269	critical splice donor site	probably null
R5165:Tpcn1	UTSW	5	120557945	missense	probably damaging	1.00
R5210:Tpcn1	UTSW	5	120539214	missense	probably damaging	1.00
R5910:Tpcn1	UTSW	5	120547397	intron	probably benign
R5939:Tpcn1	UTSW	5	120539827	missense	probably damaging	1.00
R6633:Tpcn1	UTSW	5	120544464	missense	probably benign	0.03
R6650:Tpcn1	UTSW	5	120537562	missense	probably null	0.50
R6885:Tpcn1	UTSW	5	120544437	missense	probably benign	0.21
R7038:Tpcn1	UTSW	5	120585277	missense	probably damaging	0.99
R7247:Tpcn1	UTSW	5	120585250	missense	possibly damaging	0.63
R7594:Tpcn1	UTSW	5	120556530	missense	possibly damaging	0.67
R7629:Tpcn1	UTSW	5	120537937	missense	probably benign	0.00
R7854:Tpcn1	UTSW	5	120549588	missense	probably damaging	1.00
R8478:Tpcn1	UTSW	5	120560321	missense	probably benign
R8967:Tpcn1	UTSW	5	120555958	missense	probably damaging	0.98
R8970:Tpcn1	UTSW	5	120544453	missense	probably damaging	1.00
R9137:Tpcn1	UTSW	5	120557925	missense	probably damaging	1.00
R9179:Tpcn1	UTSW	5	120541950	missense	probably damaging	1.00
R9180:Tpcn1	UTSW	5	120555935	missense	probably benign	0.00
R9241:Tpcn1	UTSW	5	120553493	missense	probably benign	0.01
R9341:Tpcn1	UTSW	5	120540672	missense	possibly damaging	0.81
R9343:Tpcn1	UTSW	5	120540672	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- TCAGCCCTGTGTTCACTGAG -3'
(R):5'- GTTGGGGCATTCTAGCAGAG -3'

Sequencing Primer
(F):5'- CTGTGTTCACTGAGACCAGG -3'
(R):5'- TTCTCACAGGGACAGGTGAC -3'

Posted On

2018-04-27