Mutagenetix > Incidental Mutations

Incidental Mutation 'R6364:Sdk1'

513403

Institutional Source

Beutler Lab

Gene Symbol

Sdk1

Ensembl Gene

ENSMUSG00000039683

Gene Name

sidekick cell adhesion molecule 1

Synonyms

6720466O15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R6364 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141241490-142215586 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 141962709 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 603 (S603I)

Ref Sequence

ENSEMBL: ENSMUSP00000082928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]

AlphaFold

Q3UH53

Predicted Effect

probably benign
Transcript: ENSMUST00000074546
AA Change: S343I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683
AA Change: S343I

Domain	Start	End	E-Value	Type
IGc2	28	91	4.67e-4	SMART
IGc2	121	187	1.45e-9	SMART
IGc2	214	282	1.58e-10	SMART
IG	302	387	1.8e-5	SMART
FN3	390	474	7.39e-14	SMART
FN3	490	576	8.96e-13	SMART
FN3	591	679	1.95e-4	SMART
FN3	694	776	2e-10	SMART
FN3	792	879	4.22e-9	SMART
FN3	896	983	1.41e-10	SMART
FN3	999	1084	2.7e-7	SMART
FN3	1100	1183	1.3e-9	SMART
FN3	1199	1284	2.19e-7	SMART
FN3	1300	1408	5.73e-11	SMART
FN3	1424	1509	1.79e-12	SMART
FN3	1524	1611	1.16e-11	SMART
FN3	1625	1709	1.32e-10	SMART
transmembrane domain	1730	1752	N/A	INTRINSIC
low complexity region	1806	1815	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000085774
AA Change: S603I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683
AA Change: S603I

Domain	Start	End	E-Value	Type
low complexity region	2	29	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
IGc2	99	158	2.77e-6	SMART
IG	179	264	3.74e-3	SMART
IGc2	288	351	4.67e-4	SMART
IGc2	381	447	1.45e-9	SMART
IGc2	474	542	1.58e-10	SMART
IG	562	647	1.8e-5	SMART
FN3	650	734	7.39e-14	SMART
FN3	750	836	8.96e-13	SMART
FN3	851	939	1.95e-4	SMART
FN3	954	1036	2e-10	SMART
FN3	1052	1139	4.22e-9	SMART
FN3	1156	1243	1.41e-10	SMART
FN3	1259	1344	2.7e-7	SMART
FN3	1360	1443	1.3e-9	SMART
FN3	1459	1544	2.19e-7	SMART
FN3	1560	1668	5.73e-11	SMART
FN3	1684	1769	1.79e-12	SMART
FN3	1784	1871	1.16e-11	SMART
FN3	1885	1969	1.32e-10	SMART
transmembrane domain	1990	2012	N/A	INTRINSIC
low complexity region	2066	2075	N/A	INTRINSIC
low complexity region	2106	2118	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,721,814	Y234C	possibly damaging	Het
Als2cr12	G	T	1: 58,658,372	A403D	probably damaging	Het
Ambra1	C	A	2: 91,773,316	H548Q	possibly damaging	Het
Ap3d1	T	C	10: 80,710,494		probably null	Het
Apol11b	A	G	15: 77,638,058	V13A	possibly damaging	Het
Arhgdib	C	T	6: 136,932,255		probably null	Het
B3galt1	T	A	2: 68,118,672	S244T	probably damaging	Het
Bace2	A	G	16: 97,413,433	I274V	probably benign	Het
Bfsp2	A	T	9: 103,448,628	V272D	probably damaging	Het
Blm	A	T	7: 80,494,526	C782*	probably null	Het
Cfi	G	A	3: 129,872,846	S406N	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	A	7: 25,272,823	H660N	possibly damaging	Het
Cops3	A	G	11: 59,835,404		probably benign	Het
Dlec1	G	A	9: 119,121,871	V502I	possibly damaging	Het
Epop	A	G	11: 97,628,687	S199P	probably benign	Het
Evi5	G	T	5: 107,842,113	P80Q	probably damaging	Het
Faf1	T	C	4: 109,961,800	V623A	possibly damaging	Het
Fam129c	G	A	8: 71,599,089	G23S	probably benign	Het
Fam83c	T	C	2: 155,834,523	D109G	probably damaging	Het
Fam83d	T	C	2: 158,783,259		probably null	Het
Foxn3	T	C	12: 99,388,693	N71D	probably benign	Het
Gm7298	A	G	6: 121,779,443	R1016G	possibly damaging	Het
Grin2d	T	C	7: 45,858,454	E396G	possibly damaging	Het
Htra2	C	A	6: 83,053,046	V311F	probably damaging	Het
Kif6	A	T	17: 49,620,623	T33S	probably benign	Het
Kmt2c	T	C	5: 25,309,636	I3070V	probably null	Het
Krtap5-2	A	T	7: 142,175,063	C293*	probably null	Het
Lrp3	T	A	7: 35,203,709	D404V	probably benign	Het
Mc2r	T	G	18: 68,407,536	I229L	probably benign	Het
Mtnr1b	A	G	9: 15,863,004	M253T	possibly damaging	Het
Nfat5	A	G	8: 107,368,277	N531S	probably benign	Het
Npr2	T	A	4: 43,643,622	I550N	probably damaging	Het
Npy6r	T	C	18: 44,276,511	I333T	possibly damaging	Het
Nup88	C	T	11: 70,947,786	R468Q	probably benign	Het
Nup98	G	A	7: 102,176,315	T422I	probably damaging	Het
Olfr433	T	A	1: 174,042,212	H87Q	possibly damaging	Het
Oraov1	A	G	7: 144,919,268	D105G	probably benign	Het
Otud4	A	G	8: 79,646,341	N96S	probably damaging	Het
Paqr6	T	C	3: 88,365,958	F86L	probably damaging	Het
Ppp4r3b	A	T	11: 29,188,035	T90S	probably benign	Het
Ptbp2	A	T	3: 119,740,442	N23K	probably damaging	Het
Ralgapb	G	T	2: 158,462,109	G596V	probably damaging	Het
Rdm1	G	A	11: 101,630,242	R94H	probably benign	Het
Rergl	A	T	6: 139,500,748	F28I	probably damaging	Het
Rif1	G	T	2: 52,107,669	S1000I	probably damaging	Het
Rnf141	C	T	7: 110,821,309	A163T	possibly damaging	Het
Scaf4	G	A	16: 90,260,248	Q72*	probably null	Het
Sdsl	T	C	5: 120,460,609	I147M	probably damaging	Het
Serpina6	T	C	12: 103,654,236	N85D	probably benign	Het
Serpinf2	A	G	11: 75,436,489	I204T	probably damaging	Het
Shank2	A	G	7: 144,410,409	S795G	probably benign	Het
Simc1	C	T	13: 54,524,600	Q254*	probably null	Het
Slc30a3	G	A	5: 31,088,739	P216S	possibly damaging	Het
Smim14	T	A	5: 65,453,296	I53F	probably benign	Het
Sp3	T	C	2: 72,970,941	T243A	probably benign	Het
Srpk2	A	G	5: 23,540,467	F164L	probably damaging	Het
Stard9	T	C	2: 120,713,429	F4403L	probably damaging	Het
Tbc1d30	T	C	10: 121,294,725	T267A	possibly damaging	Het
Tgm7	T	A	2: 121,096,397	R424*	probably null	Het
Tmbim6	T	C	15: 99,406,185	L113P	probably damaging	Het
Tmcc1	G	A	6: 116,043,761		probably benign	Het
Tomm7	A	G	5: 23,844,030	L15P	probably damaging	Het
Tpcn1	T	C	5: 120,553,810	Y263C	probably damaging	Het
Trim34b	T	C	7: 104,336,526	F456S	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r108	A	G	17: 20,470,998	I421T	probably benign	Het
Wdr43	A	G	17: 71,657,654	E676G	probably damaging	Het
Wdr60	A	T	12: 116,241,732	D412E	probably damaging	Het
Zcchc14	G	T	8: 121,604,859		probably benign	Het
Zfp64	C	A	2: 168,912,266	G25V	probably damaging	Het
Zswim8	C	A	14: 20,713,011	P326H	probably damaging	Het

Other mutations in Sdk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Sdk1	APN	5	142085606	missense	probably damaging	1.00
IGL00945:Sdk1	APN	5	142084613	critical splice donor site	probably null
IGL00946:Sdk1	APN	5	142084613	critical splice donor site	probably null
IGL01394:Sdk1	APN	5	141613215	missense	probably benign	0.03
IGL01398:Sdk1	APN	5	141937577	missense	probably benign	0.00
IGL01410:Sdk1	APN	5	142212120	missense	probably benign	0.30
IGL01525:Sdk1	APN	5	141999920	missense	probably damaging	1.00
IGL01548:Sdk1	APN	5	142085765	missense	possibly damaging	0.95
IGL01672:Sdk1	APN	5	142185175	missense	probably benign	0.33
IGL01676:Sdk1	APN	5	142127836	missense	probably damaging	0.99
IGL01679:Sdk1	APN	5	142046164	missense	probably benign
IGL01929:Sdk1	APN	5	141953030	missense	probably damaging	0.99
IGL01970:Sdk1	APN	5	142085682	missense	possibly damaging	0.67
IGL02016:Sdk1	APN	5	142034429	missense	possibly damaging	0.85
IGL02060:Sdk1	APN	5	141953012	missense	possibly damaging	0.79
IGL02457:Sdk1	APN	5	141953016	missense	probably damaging	1.00
IGL02634:Sdk1	APN	5	141610032	missense	probably benign	0.01
IGL02637:Sdk1	APN	5	142094572	missense	probably damaging	1.00
IGL02731:Sdk1	APN	5	142172544	missense	probably damaging	1.00
IGL03180:Sdk1	APN	5	142085742	missense	probably damaging	0.96
IGL03259:Sdk1	APN	5	141953033	nonsense	probably null
PIT4453001:Sdk1	UTSW	5	142212038	missense	probably benign	0.00
PIT4544001:Sdk1	UTSW	5	141956232	missense	probably benign	0.08
R0149:Sdk1	UTSW	5	141857054	intron	probably benign
R0173:Sdk1	UTSW	5	142173809	splice site	probably benign
R0240:Sdk1	UTSW	5	141998747	missense	probably damaging	1.00
R0240:Sdk1	UTSW	5	141998747	missense	probably damaging	1.00
R0242:Sdk1	UTSW	5	142143922	splice site	probably benign
R0245:Sdk1	UTSW	5	141954958	missense	probably benign	0.02
R0270:Sdk1	UTSW	5	142084566	missense	possibly damaging	0.79
R0398:Sdk1	UTSW	5	141962721	missense	probably benign	0.05
R0401:Sdk1	UTSW	5	142046161	missense	possibly damaging	0.55
R0501:Sdk1	UTSW	5	141937718	missense	probably benign
R0558:Sdk1	UTSW	5	142132065	missense	probably damaging	1.00
R0652:Sdk1	UTSW	5	141954958	missense	probably benign	0.02
R0834:Sdk1	UTSW	5	141242024	missense	probably benign
R0962:Sdk1	UTSW	5	142161875	missense	probably damaging	1.00
R1424:Sdk1	UTSW	5	142161866	missense	probably damaging	1.00
R1438:Sdk1	UTSW	5	142038323	missense	probably damaging	0.96
R1517:Sdk1	UTSW	5	142127836	missense	probably damaging	0.99
R1519:Sdk1	UTSW	5	141999950	missense	probably benign	0.00
R1539:Sdk1	UTSW	5	142094599	missense	probably damaging	1.00
R1574:Sdk1	UTSW	5	141998879	missense	probably benign	0.03
R1574:Sdk1	UTSW	5	141998879	missense	probably benign	0.03
R1673:Sdk1	UTSW	5	141948506	missense	possibly damaging	0.90
R1686:Sdk1	UTSW	5	142034537	missense	probably benign	0.00
R1806:Sdk1	UTSW	5	141613195	missense	probably damaging	1.00
R1806:Sdk1	UTSW	5	142161926	missense	probably benign
R1925:Sdk1	UTSW	5	142185285	missense	probably benign	0.09
R1956:Sdk1	UTSW	5	142094581	missense	probably damaging	1.00
R1976:Sdk1	UTSW	5	142143818	missense	probably damaging	1.00
R2124:Sdk1	UTSW	5	142185188	missense	possibly damaging	0.70
R2152:Sdk1	UTSW	5	141792944	missense	probably damaging	1.00
R2186:Sdk1	UTSW	5	142046292	missense	probably benign	0.00
R2187:Sdk1	UTSW	5	142114574	missense	probably damaging	1.00
R2306:Sdk1	UTSW	5	141962700	missense	probably benign	0.00
R2520:Sdk1	UTSW	5	142085771	missense	probably benign	0.19
R2698:Sdk1	UTSW	5	142212050	missense	possibly damaging	0.95
R2763:Sdk1	UTSW	5	142084551	missense	possibly damaging	0.90
R3023:Sdk1	UTSW	5	142046236	missense	probably benign
R3500:Sdk1	UTSW	5	142006616	splice site	probably benign
R3613:Sdk1	UTSW	5	142119686	missense	probably damaging	1.00
R3824:Sdk1	UTSW	5	141936049	missense	probably benign
R3916:Sdk1	UTSW	5	142051244	missense	probably damaging	0.98
R3917:Sdk1	UTSW	5	142051244	missense	probably damaging	0.98
R4158:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4160:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4161:Sdk1	UTSW	5	142114399	missense	probably benign	0.00
R4386:Sdk1	UTSW	5	142094626	missense	probably damaging	0.99
R4649:Sdk1	UTSW	5	142006625	missense	probably damaging	1.00
R4701:Sdk1	UTSW	5	142185231	missense	probably damaging	1.00
R4780:Sdk1	UTSW	5	141959238	missense	probably damaging	0.97
R4787:Sdk1	UTSW	5	141582413	missense	probably benign
R4825:Sdk1	UTSW	5	141582294	missense	probably benign	0.11
R4853:Sdk1	UTSW	5	142146263	missense	probably damaging	1.00
R4857:Sdk1	UTSW	5	142161776	missense	probably benign	0.01
R4928:Sdk1	UTSW	5	141857003	intron	probably benign
R5111:Sdk1	UTSW	5	142127845	missense	probably damaging	1.00
R5188:Sdk1	UTSW	5	141956260	critical splice donor site	probably null
R5246:Sdk1	UTSW	5	142114562	missense	possibly damaging	0.72
R5273:Sdk1	UTSW	5	141998828	missense	probably damaging	0.99
R5484:Sdk1	UTSW	5	142100186	missense	probably damaging	1.00
R5525:Sdk1	UTSW	5	142185265	missense	possibly damaging	0.84
R5578:Sdk1	UTSW	5	141613125	nonsense	probably null
R5593:Sdk1	UTSW	5	141956124	missense	probably damaging	0.98
R5654:Sdk1	UTSW	5	141936098	missense	probably damaging	0.96
R5672:Sdk1	UTSW	5	142188145	missense	possibly damaging	0.94
R5768:Sdk1	UTSW	5	142143871	missense	probably benign	0.00
R5781:Sdk1	UTSW	5	141936048	missense	probably benign	0.00
R5846:Sdk1	UTSW	5	142114393	missense	probably damaging	1.00
R5851:Sdk1	UTSW	5	141962669	missense	probably benign	0.00
R6164:Sdk1	UTSW	5	142132069	missense	probably damaging	1.00
R6235:Sdk1	UTSW	5	142034426	missense	possibly damaging	0.85
R6453:Sdk1	UTSW	5	142096921	missense	probably damaging	1.00
R6892:Sdk1	UTSW	5	142046298	missense	probably benign	0.00
R6996:Sdk1	UTSW	5	142212014	missense	probably benign	0.16
R7003:Sdk1	UTSW	5	142096734	missense	probably benign	0.01
R7022:Sdk1	UTSW	5	142094657	splice site	probably null
R7027:Sdk1	UTSW	5	142096726	splice site	probably null
R7098:Sdk1	UTSW	5	142096870	missense	probably damaging	0.96
R7107:Sdk1	UTSW	5	142081716	missense	probably damaging	0.99
R7203:Sdk1	UTSW	5	142046176	missense	probably benign	0.08
R7313:Sdk1	UTSW	5	141937622	missense	probably damaging	0.97
R7363:Sdk1	UTSW	5	142188142	missense	probably benign	0.05
R7375:Sdk1	UTSW	5	141998843	missense	probably benign	0.01
R7446:Sdk1	UTSW	5	142144976	missense	probably damaging	1.00
R7527:Sdk1	UTSW	5	141792976	missense	possibly damaging	0.61
R7598:Sdk1	UTSW	5	141609998	nonsense	probably null
R7747:Sdk1	UTSW	5	142084491	missense	probably damaging	1.00
R7810:Sdk1	UTSW	5	141937679	missense	probably benign
R7985:Sdk1	UTSW	5	142127847	missense	probably damaging	1.00
R8129:Sdk1	UTSW	5	142191893	missense	probably benign	0.10
R8217:Sdk1	UTSW	5	142211958	missense	possibly damaging	0.81
R8249:Sdk1	UTSW	5	142188015	critical splice acceptor site	probably null
R8376:Sdk1	UTSW	5	142158621	missense	possibly damaging	0.83
R8779:Sdk1	UTSW	5	141962702	missense	probably benign	0.00
R8807:Sdk1	UTSW	5	142085627	missense	probably damaging	1.00
R8907:Sdk1	UTSW	5	142084523	missense	probably damaging	0.99
R8942:Sdk1	UTSW	5	142096843	missense	probably damaging	1.00
R8945:Sdk1	UTSW	5	141613180	missense	probably benign
R9006:Sdk1	UTSW	5	141937566	missense	probably damaging	1.00
R9249:Sdk1	UTSW	5	142143795	missense	probably damaging	1.00
R9275:Sdk1	UTSW	5	141956198	missense	possibly damaging	0.95
R9345:Sdk1	UTSW	5	142161953	missense	probably benign
X0017:Sdk1	UTSW	5	141998780	missense	probably benign	0.00
Z1176:Sdk1	UTSW	5	141959310	missense	probably null	0.58
Z1177:Sdk1	UTSW	5	141962708	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CTGAGATATTGCCATAAAACTCTCC -3'
(R):5'- ATGAGTCAAGTATGGCCGCG -3'

Sequencing Primer
(F):5'- CTGGAATTCTAGGTCATGAGTCACC -3'
(R):5'- AGTATGGCCGCGTGGAAGTC -3'

Posted On

2018-04-27