Incidental Mutation 'R6364:Cic'
ID513408
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Namecapicua transcriptional repressor
Synonyms1200010B10Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R6364 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location25267704-25294159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25272823 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 660 (H660N)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169266] [ENSMUST00000169392]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169266
AA Change: H660N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: H660N

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169392
SMART Domains Protein: ENSMUSP00000131680
Gene: ENSMUSG00000005442

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Lrp3 T A 7: 35,203,709 D404V probably benign Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 25292124 missense probably damaging 1.00
IGL01668:Cic APN 7 25291204 missense possibly damaging 0.47
IGL02229:Cic APN 7 25290950 missense probably damaging 0.96
IGL02506:Cic APN 7 25290857 missense probably benign
IGL02794:Cic APN 7 25285644 missense probably damaging 1.00
IGL03065:Cic APN 7 25285821 splice site probably benign
IGL03304:Cic APN 7 25284849 missense probably damaging 1.00
1mM(1):Cic UTSW 7 25290789 splice site probably benign
IGL03046:Cic UTSW 7 25291075 missense probably damaging 1.00
R0012:Cic UTSW 7 25287140 missense probably damaging 0.98
R0012:Cic UTSW 7 25287141 missense probably damaging 1.00
R0027:Cic UTSW 7 25287140 missense probably damaging 0.98
R0027:Cic UTSW 7 25287141 missense probably damaging 1.00
R0038:Cic UTSW 7 25287140 missense probably damaging 0.98
R0038:Cic UTSW 7 25287141 missense probably damaging 1.00
R0063:Cic UTSW 7 25287140 missense probably damaging 0.98
R0063:Cic UTSW 7 25287141 missense probably damaging 1.00
R0064:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287141 missense probably damaging 1.00
R0118:Cic UTSW 7 25286034 missense probably damaging 1.00
R0193:Cic UTSW 7 25287140 missense probably damaging 0.98
R0193:Cic UTSW 7 25287141 missense probably damaging 1.00
R0241:Cic UTSW 7 25287140 missense probably damaging 0.98
R0241:Cic UTSW 7 25287141 missense probably damaging 1.00
R0377:Cic UTSW 7 25285799 missense probably damaging 0.98
R0462:Cic UTSW 7 25287140 missense probably damaging 0.98
R0462:Cic UTSW 7 25287141 missense probably damaging 1.00
R0800:Cic UTSW 7 25285237 missense probably benign
R1253:Cic UTSW 7 25290948 missense probably damaging 1.00
R1458:Cic UTSW 7 25279737 intron probably benign
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1519:Cic UTSW 7 25293810 critical splice acceptor site probably null
R1586:Cic UTSW 7 25285961 missense probably damaging 1.00
R1824:Cic UTSW 7 25288266 missense probably damaging 1.00
R1908:Cic UTSW 7 25286840 missense probably damaging 1.00
R2045:Cic UTSW 7 25271536 missense possibly damaging 0.53
R2063:Cic UTSW 7 25273451 missense probably damaging 0.98
R2161:Cic UTSW 7 25288134 unclassified probably null
R2495:Cic UTSW 7 25291776 splice site probably benign
R2865:Cic UTSW 7 25273221 missense probably damaging 0.96
R3692:Cic UTSW 7 25288913 nonsense probably null
R3709:Cic UTSW 7 25286981 missense probably damaging 0.99
R3710:Cic UTSW 7 25286981 missense probably damaging 0.99
R3872:Cic UTSW 7 25271699 missense possibly damaging 0.92
R3946:Cic UTSW 7 25272346 missense possibly damaging 0.93
R4199:Cic UTSW 7 25291670 frame shift probably null
R4426:Cic UTSW 7 25294008 utr 3 prime probably benign
R4502:Cic UTSW 7 25288467 missense probably damaging 1.00
R4585:Cic UTSW 7 25272778 missense probably benign 0.33
R4586:Cic UTSW 7 25272778 missense probably benign 0.33
R4614:Cic UTSW 7 25291670 frame shift probably null
R4664:Cic UTSW 7 25290674 small deletion probably benign
R4688:Cic UTSW 7 25291670 frame shift probably null
R4695:Cic UTSW 7 25273588 missense possibly damaging 0.72
R4696:Cic UTSW 7 25288483 missense probably benign
R4746:Cic UTSW 7 25288480 missense probably damaging 1.00
R4758:Cic UTSW 7 25292211 missense possibly damaging 0.62
R4767:Cic UTSW 7 25271600 missense possibly damaging 0.92
R4776:Cic UTSW 7 25282883 missense possibly damaging 0.95
R4820:Cic UTSW 7 25271732 missense possibly damaging 0.92
R4850:Cic UTSW 7 25272902 missense probably damaging 0.98
R4851:Cic UTSW 7 25272902 missense probably damaging 0.98
R4922:Cic UTSW 7 25291670 small insertion probably benign
R4989:Cic UTSW 7 25287110 missense probably damaging 1.00
R5131:Cic UTSW 7 25291670 small insertion probably benign
R5718:Cic UTSW 7 25272778 missense probably benign 0.33
R5801:Cic UTSW 7 25271438 missense possibly damaging 0.93
R5949:Cic UTSW 7 25272305 missense probably damaging 1.00
R6000:Cic UTSW 7 25271998 missense probably benign 0.33
R6246:Cic UTSW 7 25271642 missense probably damaging 1.00
R6283:Cic UTSW 7 25286034 missense probably damaging 1.00
R6481:Cic UTSW 7 25288281 missense possibly damaging 0.56
R6919:Cic UTSW 7 25271777 missense probably benign 0.04
R6920:Cic UTSW 7 25290682 missense probably damaging 1.00
R6995:Cic UTSW 7 25271311 missense possibly damaging 0.53
R7002:Cic UTSW 7 25272196 missense probably damaging 0.99
R7113:Cic UTSW 7 25273444 missense probably benign 0.08
R7560:Cic UTSW 7 25272853 missense probably damaging 0.98
V7732:Cic UTSW 7 25292245 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACGCTTCGAGTTTGATGAG -3'
(R):5'- TCACTCTTGGGGAAGTCTGG -3'

Sequencing Primer
(F):5'- GATGAGTGTGAGGCGGC -3'
(R):5'- CCCCCAATGTCCCTGGATG -3'
Posted On2018-04-27