Mutagenetix > Incidental Mutations

Incidental Mutation 'R6364:Cic'

513408

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene?

Probably essential (E-score: 0.894) question?

Stock #

R6364 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25267704-25294159 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 25272823 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 660 (H660N)

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169266] [ENSMUST00000169392]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169266
AA Change: H660N

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: H660N

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169392

SMART Domains

Protein: ENSMUSP00000131680
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.8%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts3	T	C	5: 89,721,814	Y234C	possibly damaging	Het
Als2cr12	G	T	1: 58,658,372	A403D	probably damaging	Het
Ambra1	C	A	2: 91,773,316	H548Q	possibly damaging	Het
Ap3d1	T	C	10: 80,710,494		probably null	Het
Apol11b	A	G	15: 77,638,058	V13A	possibly damaging	Het
Arhgdib	C	T	6: 136,932,255		probably null	Het
B3galt1	T	A	2: 68,118,672	S244T	probably damaging	Het
Bace2	A	G	16: 97,413,433	I274V	probably benign	Het
Bfsp2	A	T	9: 103,448,628	V272D	probably damaging	Het
Blm	A	T	7: 80,494,526	C782*	probably null	Het
Cfi	G	A	3: 129,872,846	S406N	probably benign	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cops3	A	G	11: 59,835,404		probably benign	Het
Dlec1	G	A	9: 119,121,871	V502I	possibly damaging	Het
Epop	A	G	11: 97,628,687	S199P	probably benign	Het
Evi5	G	T	5: 107,842,113	P80Q	probably damaging	Het
Faf1	T	C	4: 109,961,800	V623A	possibly damaging	Het
Fam129c	G	A	8: 71,599,089	G23S	probably benign	Het
Fam83c	T	C	2: 155,834,523	D109G	probably damaging	Het
Fam83d	T	C	2: 158,783,259		probably null	Het
Foxn3	T	C	12: 99,388,693	N71D	probably benign	Het
Gm7298	A	G	6: 121,779,443	R1016G	possibly damaging	Het
Grin2d	T	C	7: 45,858,454	E396G	possibly damaging	Het
Htra2	C	A	6: 83,053,046	V311F	probably damaging	Het
Kif6	A	T	17: 49,620,623	T33S	probably benign	Het
Kmt2c	T	C	5: 25,309,636	I3070V	probably null	Het
Krtap5-2	A	T	7: 142,175,063	C293*	probably null	Het
Lrp3	T	A	7: 35,203,709	D404V	probably benign	Het
Mc2r	T	G	18: 68,407,536	I229L	probably benign	Het
Mtnr1b	A	G	9: 15,863,004	M253T	possibly damaging	Het
Nfat5	A	G	8: 107,368,277	N531S	probably benign	Het
Npr2	T	A	4: 43,643,622	I550N	probably damaging	Het
Npy6r	T	C	18: 44,276,511	I333T	possibly damaging	Het
Nup88	C	T	11: 70,947,786	R468Q	probably benign	Het
Nup98	G	A	7: 102,176,315	T422I	probably damaging	Het
Olfr433	T	A	1: 174,042,212	H87Q	possibly damaging	Het
Oraov1	A	G	7: 144,919,268	D105G	probably benign	Het
Otud4	A	G	8: 79,646,341	N96S	probably damaging	Het
Paqr6	T	C	3: 88,365,958	F86L	probably damaging	Het
Ppp4r3b	A	T	11: 29,188,035	T90S	probably benign	Het
Ptbp2	A	T	3: 119,740,442	N23K	probably damaging	Het
Ralgapb	G	T	2: 158,462,109	G596V	probably damaging	Het
Rdm1	G	A	11: 101,630,242	R94H	probably benign	Het
Rergl	A	T	6: 139,500,748	F28I	probably damaging	Het
Rif1	G	T	2: 52,107,669	S1000I	probably damaging	Het
Rnf141	C	T	7: 110,821,309	A163T	possibly damaging	Het
Scaf4	G	A	16: 90,260,248	Q72*	probably null	Het
Sdk1	G	T	5: 141,962,709	S603I	probably benign	Het
Sdsl	T	C	5: 120,460,609	I147M	probably damaging	Het
Serpina6	T	C	12: 103,654,236	N85D	probably benign	Het
Serpinf2	A	G	11: 75,436,489	I204T	probably damaging	Het
Shank2	A	G	7: 144,410,409	S795G	probably benign	Het
Simc1	C	T	13: 54,524,600	Q254*	probably null	Het
Slc30a3	G	A	5: 31,088,739	P216S	possibly damaging	Het
Smim14	T	A	5: 65,453,296	I53F	probably benign	Het
Sp3	T	C	2: 72,970,941	T243A	probably benign	Het
Srpk2	A	G	5: 23,540,467	F164L	probably damaging	Het
Stard9	T	C	2: 120,713,429	F4403L	probably damaging	Het
Tbc1d30	T	C	10: 121,294,725	T267A	possibly damaging	Het
Tgm7	T	A	2: 121,096,397	R424*	probably null	Het
Tmbim6	T	C	15: 99,406,185	L113P	probably damaging	Het
Tmcc1	G	A	6: 116,043,761		probably benign	Het
Tomm7	A	G	5: 23,844,030	L15P	probably damaging	Het
Tpcn1	T	C	5: 120,553,810	Y263C	probably damaging	Het
Trim34b	T	C	7: 104,336,526	F456S	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vmn2r108	A	G	17: 20,470,998	I421T	probably benign	Het
Wdr43	A	G	17: 71,657,654	E676G	probably damaging	Het
Wdr60	A	T	12: 116,241,732	D412E	probably damaging	Het
Zcchc14	G	T	8: 121,604,859		probably benign	Het
Zfp64	C	A	2: 168,912,266	G25V	probably damaging	Het
Zswim8	C	A	14: 20,713,011	P326H	probably damaging	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	25292124	missense	probably damaging	1.00
IGL01668:Cic	APN	7	25291204	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	25290950	missense	probably damaging	0.96
IGL02506:Cic	APN	7	25290857	missense	probably benign
IGL02794:Cic	APN	7	25285644	missense	probably damaging	1.00
IGL03065:Cic	APN	7	25285821	splice site	probably benign
IGL03304:Cic	APN	7	25284849	missense	probably damaging	1.00
1mM(1):Cic	UTSW	7	25290789	splice site	probably benign
IGL03046:Cic	UTSW	7	25291075	missense	probably damaging	1.00
R0012:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0012:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0027:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0027:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0038:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0038:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0063:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0063:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0064:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0064:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0118:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R0193:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0193:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0241:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0241:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0377:Cic	UTSW	7	25285799	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0800:Cic	UTSW	7	25285237	missense	probably benign
R1253:Cic	UTSW	7	25290948	missense	probably damaging	1.00
R1458:Cic	UTSW	7	25279737	intron	probably benign
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1519:Cic	UTSW	7	25293810	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	25285961	missense	probably damaging	1.00
R1824:Cic	UTSW	7	25288266	missense	probably damaging	1.00
R1908:Cic	UTSW	7	25286840	missense	probably damaging	1.00
R2045:Cic	UTSW	7	25271536	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	25273451	missense	probably damaging	0.98
R2161:Cic	UTSW	7	25288134	unclassified	probably null
R2495:Cic	UTSW	7	25291776	splice site	probably benign
R2865:Cic	UTSW	7	25273221	missense	probably damaging	0.96
R3692:Cic	UTSW	7	25288913	nonsense	probably null
R3709:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3710:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3872:Cic	UTSW	7	25271699	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	25272346	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	25291670	frame shift	probably null
R4426:Cic	UTSW	7	25294008	utr 3 prime	probably benign
R4502:Cic	UTSW	7	25288467	missense	probably damaging	1.00
R4585:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4586:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4614:Cic	UTSW	7	25291670	frame shift	probably null
R4664:Cic	UTSW	7	25290674	small deletion	probably benign
R4688:Cic	UTSW	7	25291670	frame shift	probably null
R4695:Cic	UTSW	7	25273588	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	25288483	missense	probably benign
R4746:Cic	UTSW	7	25288480	missense	probably damaging	1.00
R4758:Cic	UTSW	7	25292211	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	25271600	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	25282883	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	25271732	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4851:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4922:Cic	UTSW	7	25291670	small insertion	probably benign
R4989:Cic	UTSW	7	25287110	missense	probably damaging	1.00
R5131:Cic	UTSW	7	25291670	small insertion	probably benign
R5718:Cic	UTSW	7	25272778	missense	probably benign	0.33
R5801:Cic	UTSW	7	25271438	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	25272305	missense	probably damaging	1.00
R6000:Cic	UTSW	7	25271998	missense	probably benign	0.33
R6246:Cic	UTSW	7	25271642	missense	probably damaging	1.00
R6283:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R6481:Cic	UTSW	7	25288281	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	25271777	missense	probably benign	0.04
R6920:Cic	UTSW	7	25290682	missense	probably damaging	1.00
R6995:Cic	UTSW	7	25271311	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	25272196	missense	probably damaging	0.99
R7113:Cic	UTSW	7	25273444	missense	probably benign	0.08
R7560:Cic	UTSW	7	25272853	missense	probably damaging	0.98
V7732:Cic	UTSW	7	25292245	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCACGCTTCGAGTTTGATGAG -3'
(R):5'- TCACTCTTGGGGAAGTCTGG -3'

Sequencing Primer
(F):5'- GATGAGTGTGAGGCGGC -3'
(R):5'- CCCCCAATGTCCCTGGATG -3'

Posted On

2018-04-27