Incidental Mutation 'R6364:Lrp3'
ID513409
Institutional Source Beutler Lab
Gene Symbol Lrp3
Ensembl Gene ENSMUSG00000001802
Gene Namelow density lipoprotein receptor-related protein 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R6364 (G1)
Quality Score119.008
Status Validated
Chromosome7
Chromosomal Location35200027-35215498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35203709 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 404 (D404V)
Ref Sequence ENSEMBL: ENSMUSP00000114026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001854] [ENSMUST00000118444] [ENSMUST00000122409] [ENSMUST00000131048]
Predicted Effect probably benign
Transcript: ENSMUST00000001854
SMART Domains Protein: ENSMUSP00000001854
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 474 4.8e-65 PFAM
Pfam:AA_permease 51 467 9.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118444
AA Change: D383V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113406
Gene: ENSMUSG00000001802
AA Change: D383V

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 43 159 9.97e-20 SMART
LDLa 165 202 7.21e-11 SMART
LDLa 211 251 1.37e-11 SMART
CUB 254 365 1.98e-3 SMART
LDLa 367 414 1.85e-1 SMART
LDLa 415 453 4.44e-3 SMART
LDLa 454 490 8.74e-10 SMART
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 584 606 N/A INTRINSIC
low complexity region 641 652 N/A INTRINSIC
low complexity region 674 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122409
AA Change: D404V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114026
Gene: ENSMUSG00000001802
AA Change: D404V

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
CUB 64 180 9.97e-20 SMART
LDLa 186 223 7.21e-11 SMART
LDLa 232 272 1.37e-11 SMART
CUB 275 386 1.98e-3 SMART
LDLa 388 435 1.85e-1 SMART
LDLa 436 474 4.44e-3 SMART
LDLa 475 511 8.74e-10 SMART
transmembrane domain 518 540 N/A INTRINSIC
low complexity region 605 627 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131048
SMART Domains Protein: ENSMUSP00000118331
Gene: ENSMUSG00000030495

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
Pfam:AA_permease_2 46 346 8.6e-48 PFAM
Pfam:AA_permease 51 346 1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155404
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,721,814 Y234C possibly damaging Het
Als2cr12 G T 1: 58,658,372 A403D probably damaging Het
Ambra1 C A 2: 91,773,316 H548Q possibly damaging Het
Ap3d1 T C 10: 80,710,494 probably null Het
Apol11b A G 15: 77,638,058 V13A possibly damaging Het
Arhgdib C T 6: 136,932,255 probably null Het
B3galt1 T A 2: 68,118,672 S244T probably damaging Het
Bace2 A G 16: 97,413,433 I274V probably benign Het
Bfsp2 A T 9: 103,448,628 V272D probably damaging Het
Blm A T 7: 80,494,526 C782* probably null Het
Cfi G A 3: 129,872,846 S406N probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cic C A 7: 25,272,823 H660N possibly damaging Het
Cops3 A G 11: 59,835,404 probably benign Het
Dlec1 G A 9: 119,121,871 V502I possibly damaging Het
Epop A G 11: 97,628,687 S199P probably benign Het
Evi5 G T 5: 107,842,113 P80Q probably damaging Het
Faf1 T C 4: 109,961,800 V623A possibly damaging Het
Fam129c G A 8: 71,599,089 G23S probably benign Het
Fam83c T C 2: 155,834,523 D109G probably damaging Het
Fam83d T C 2: 158,783,259 probably null Het
Foxn3 T C 12: 99,388,693 N71D probably benign Het
Gm7298 A G 6: 121,779,443 R1016G possibly damaging Het
Grin2d T C 7: 45,858,454 E396G possibly damaging Het
Htra2 C A 6: 83,053,046 V311F probably damaging Het
Kif6 A T 17: 49,620,623 T33S probably benign Het
Kmt2c T C 5: 25,309,636 I3070V probably null Het
Krtap5-2 A T 7: 142,175,063 C293* probably null Het
Mc2r T G 18: 68,407,536 I229L probably benign Het
Mtnr1b A G 9: 15,863,004 M253T possibly damaging Het
Nfat5 A G 8: 107,368,277 N531S probably benign Het
Npr2 T A 4: 43,643,622 I550N probably damaging Het
Npy6r T C 18: 44,276,511 I333T possibly damaging Het
Nup88 C T 11: 70,947,786 R468Q probably benign Het
Nup98 G A 7: 102,176,315 T422I probably damaging Het
Olfr433 T A 1: 174,042,212 H87Q possibly damaging Het
Oraov1 A G 7: 144,919,268 D105G probably benign Het
Otud4 A G 8: 79,646,341 N96S probably damaging Het
Paqr6 T C 3: 88,365,958 F86L probably damaging Het
Ppp4r3b A T 11: 29,188,035 T90S probably benign Het
Ptbp2 A T 3: 119,740,442 N23K probably damaging Het
Ralgapb G T 2: 158,462,109 G596V probably damaging Het
Rdm1 G A 11: 101,630,242 R94H probably benign Het
Rergl A T 6: 139,500,748 F28I probably damaging Het
Rif1 G T 2: 52,107,669 S1000I probably damaging Het
Rnf141 C T 7: 110,821,309 A163T possibly damaging Het
Scaf4 G A 16: 90,260,248 Q72* probably null Het
Sdk1 G T 5: 141,962,709 S603I probably benign Het
Sdsl T C 5: 120,460,609 I147M probably damaging Het
Serpina6 T C 12: 103,654,236 N85D probably benign Het
Serpinf2 A G 11: 75,436,489 I204T probably damaging Het
Shank2 A G 7: 144,410,409 S795G probably benign Het
Simc1 C T 13: 54,524,600 Q254* probably null Het
Slc30a3 G A 5: 31,088,739 P216S possibly damaging Het
Smim14 T A 5: 65,453,296 I53F probably benign Het
Sp3 T C 2: 72,970,941 T243A probably benign Het
Srpk2 A G 5: 23,540,467 F164L probably damaging Het
Stard9 T C 2: 120,713,429 F4403L probably damaging Het
Tbc1d30 T C 10: 121,294,725 T267A possibly damaging Het
Tgm7 T A 2: 121,096,397 R424* probably null Het
Tmbim6 T C 15: 99,406,185 L113P probably damaging Het
Tmcc1 G A 6: 116,043,761 probably benign Het
Tomm7 A G 5: 23,844,030 L15P probably damaging Het
Tpcn1 T C 5: 120,553,810 Y263C probably damaging Het
Trim34b T C 7: 104,336,526 F456S probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vmn2r108 A G 17: 20,470,998 I421T probably benign Het
Wdr43 A G 17: 71,657,654 E676G probably damaging Het
Wdr60 A T 12: 116,241,732 D412E probably damaging Het
Zcchc14 G T 8: 121,604,859 probably benign Het
Zfp64 C A 2: 168,912,266 G25V probably damaging Het
Zswim8 C A 14: 20,713,011 P326H probably damaging Het
Other mutations in Lrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Lrp3 APN 7 35206028 splice site probably benign
IGL01714:Lrp3 APN 7 35206071 splice site probably null
IGL03033:Lrp3 APN 7 35202627 missense possibly damaging 0.61
IGL03166:Lrp3 APN 7 35202480 missense probably benign 0.00
Blackball UTSW 7 35206052 missense probably damaging 1.00
lowball UTSW 7 35204168 missense probably benign 0.00
PIT4434001:Lrp3 UTSW 7 35203995 missense probably damaging 0.99
R0416:Lrp3 UTSW 7 35202353 missense probably benign
R0733:Lrp3 UTSW 7 35202120 missense possibly damaging 0.93
R0907:Lrp3 UTSW 7 35203293 missense probably damaging 0.99
R1437:Lrp3 UTSW 7 35213170 missense probably damaging 1.00
R1591:Lrp3 UTSW 7 35202365 missense probably benign 0.03
R1625:Lrp3 UTSW 7 35203925 missense probably damaging 1.00
R1703:Lrp3 UTSW 7 35213161 missense possibly damaging 0.95
R3976:Lrp3 UTSW 7 35204105 missense probably benign 0.06
R4196:Lrp3 UTSW 7 35203410 missense probably damaging 1.00
R4679:Lrp3 UTSW 7 35203940 missense probably damaging 1.00
R5686:Lrp3 UTSW 7 35203485 missense possibly damaging 0.84
R5836:Lrp3 UTSW 7 35203322 missense probably damaging 1.00
R6160:Lrp3 UTSW 7 35204123 missense possibly damaging 0.79
R6342:Lrp3 UTSW 7 35202306 missense probably benign 0.01
R6415:Lrp3 UTSW 7 35204168 missense probably benign 0.00
R6502:Lrp3 UTSW 7 35203988 missense possibly damaging 0.89
R6747:Lrp3 UTSW 7 35211437 missense probably benign
R7205:Lrp3 UTSW 7 35202626 missense probably damaging 0.99
R7232:Lrp3 UTSW 7 35206052 missense probably damaging 1.00
R7522:Lrp3 UTSW 7 35204330 missense probably damaging 0.99
R7870:Lrp3 UTSW 7 35211497 missense probably damaging 0.99
R7963:Lrp3 UTSW 7 35202979 nonsense probably null
Z1177:Lrp3 UTSW 7 35203012 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGGTTGTTGCAACGATCG -3'
(R):5'- TATGTCCAGGTGTATGAAGGCC -3'

Sequencing Primer
(F):5'- TTGCAACGATCGGCAGGTG -3'
(R):5'- ACCGTCTGCTGCAAACG -3'
Posted On2018-04-27